Cryptmeria japonica (Sugi) SNP Primers

Contig ID Locus identifier forward primer reverse primer product size EST accession No.
CC0128_AU066432 gSNP00002 GACAAGAGGCCTCCTCCAAT ACAAGCAGGGAAACACGAAT 323 AU066432
CC0223_AU066453 gSNP00006 CATTTCCATTTCCCCATCAC CCTCCTCTTCCTTTGTCTGC 328 AU066453
CC0227_AU066455 gSNP00007 AGCCATGTCTCCCTTAAGCA ACCTCATGGCGAAATTCAAC 348 AU066455
CC0302_AU083628 gSNP00010 GGGCTTTTCTGAATGAATGC TGCTAAATTGCTGGATGTGG 337 AU083628
CC0357_AU083680 gSNP00013 TTCTTAATTCCTCAACATGCCA ATGCATATATTGATTGGCCC 352 AU083680
CC0359_AU083681 gSNP00014 CTCCTTGATCGAATTCTGGC GGCGCCTTCCACATAGTAAA 346 AU083681
CC0399_AU083709 gSNP00017 AGGAGCATGCCATGAAAGAC CAAGCGCAGATCACTGAAGA 420 AU083709
CC0417_AU083726 gSNP00019 ATCACAGACATATTGGGCCG TTCCTGTACTGCACATCCACA 329 AU083726
CC0479_AU083769 gSNP00024 AATCGAAAAGTAGACCGGCA ATCGAGCGTCTCCTGATGAT 382 AU083769
CC0583_AU083856 gSNP00027 AATAGTGCGCCGTGTTGAAT CGATGAGGAGGAGACCTACG 360 AU083856
CC0630_AU083887 gSNP00031 ATGAAGAAACCGTCAAGGACC TGAATTCGTCCATTGAAACG 327 AU083887
CC0642_AU083898 gSNP00032 CCTGTAGCACATAACCCAAAA CAACCACCTGAGCAATACCA 360 AU083898
CC0665_AU083915 gSNP00033 AAACAAAACAGGGTTCACCA TTTTTGCAATTGTTGTGGGC 327 AU083915
CC0669_AU083919 gSNP00034 TGTCAAACAGTTCCCTGCCT TGGCTACTTGTGGGTTTCAA 378 AU083919
CC0839_AU084053 gSNP00044 AACACGAAAAGGATTGCAGG GTTGCCTGTCCAGTACGCTC 342 AU084053
CC0840_AU084054 gSNP00045 TGGGATAGCATCTTCATTTGG AGCGGCTTGAATACCATTCT 393 AU084054
CC0993_AU084180 gSNP00047 AGCCACTCTGAGCAAGGAGA TCCTTGAAACCTTTGTACCGA 321 AU084180
CC10013_BW992260 gSNP00049 GTGATGAGAACCCAAATGCC TGCAACTTCACATTCCCAAA 300 BW992260
CC10034_BW992283 gSNP00052 ACAGAAAGTCTCCCGTGTGG AACAGATTTGCAGAGGGCAC 480 BW992283
CC10035_BW992285 gSNP00053 AGCTCCTTGTCTACCTCGCA TTCTTTGCGACCTGGATCTT 350 BW992285
CC10043_BW992293 gSNP00054 GATAGCGGAGTCAGGTCTGG TCGCTCCTTTGCACAATATG 447 BW992293
CC10050_BW992302 gSNP00055 ACTCCCCGAATGTCAGTGTC GCCCCTTTTCAGAAGTAGCA 398 BW992302
CC10063_BW992319 gSNP00058 TTGAACAGTGCGGGATAGTG GCGACATGTTGTTGAGCAGT 457 BW992319
CC10081_BW992338 gSNP00060 TAATCTCTTTCGTGGGGCTG AAGCATCTTCCCCATTTTCC 464 BW992338
CC10082_BW992339 gSNP00061 TGTGTTATTTGTGTTTTGTCTGTTG GCAACGATTGAATAAGGTGACA 515 BW992339
CC10085_BW992345 gSNP00062 CATCCCCTCAAGGAAGTGAA AGCATTCCAATTTTCATCGG 444 BW992345
CC10088_BW992349 gSNP00063 TCAATTCAGACCTGGGCTTC TATTTCCTGAACAGAGGGGG 470 BW992349
CC10165_BW992442 gSNP00066 GGGTCAAAGTTGCCCTTGTA CTTCGCTCTCTTCAAAACGG 355 BW992442
CC10168_BW992445 gSNP00067 AGGAGAGAAAAACGCCGAAT GATTTTCTCGCCCTCTTCCT 382 BW992445
CC10169_BW992447 gSNP00068 GGAATGGACTTCTCAGCAGG AGCTCTCTTCAACATCCCCA 378 BW992447
CC1016_AU084201 gSNP00069 TGACATCATGGAAGCTCCTCT GGAATTCCTCCTGCTCCC 364 AU084201
CC10187_BW992472 gSNP00072 TCTCTGTTCATTGTGAGCCCT AGTACGGAATTTCTTGAGTGCAG 373 BW992472
CC10201_BW992489 gSNP00073 CCCCACATGAGGAGAAAGAA TTTTTATGGCACCACCCATT 414 BW992489
CC10210_BW992500 gSNP00074 AACTTTTGCAGCAGAGGCAT ACTTTGGCGCAGAAATAAGC 334 BW992500
CC10217_BW992506 gSNP00075 ACAAGCGGGAATCACCATAG GCTTACCCACATCCAATGCT 364 BW992506
CC10228_BW992517 gSNP00077 TCAAGCTTGCAGATCCTGTG CAGTCACCCACGCTAATTGA 422 BW992517
CC10232_BW992522 gSNP00078 GGAAGAGCTTGTTTTCCGTG GAATCAAAGCTTCTCGTGCC 461 BW992522
CC10234_BW992524 gSNP00079 TGGAAAACCAACAAGGGATT CGGAACTCCGTGAATGTGTA 429 BW992524
CC10254_BW992542 gSNP00080 ATCTTGGGATGAAGAGCGTG ACGACCAGGAATTTTACCCC 385 BW992542
CC10255_BW992543 gSNP00081 TCGAAACCCTAAACCCTACG GGGTTTTGGTGATGTCGAAG 374 BW992543
CC10257_BW992546 gSNP00082 CGAAATCAGCGTTGCACTAC GGATTCTCAACACCTGACGC 389 BW992546
CC10261_BW992552 gSNP00083 GTTCCATTGAATTCCATCACCT AAATGGAGGCACAGAAATGG 327 BW992552
CC10295_BW992595 gSNP00088 TTTGAAATTCGCAAGGTTGA CTGCATGTCAGCAAAGCCTA 315 BW992595
CC10308_BW992610 gSNP00090 GGTTGATTTCAATCCCTTTTCA GCCTCATCAAATGTGAACACTC 444 BW992610
CC10309_BW992612 gSNP00091 CAAGAAGTGAGCTTGCAATCAG TGCAGAGTGAGAGGTTCCTG 438 BW992612
CC10342_BW992656 gSNP00093 TTTCGTCATTCAAGCAAGACA AGGAACAAGTCTCCAGGTGC 435 BW992656
CC10357_BW992674 gSNP00094 CCTGGTAATAATGTTGCATTCTTTT CATTGAGGGTTCCTGCAAAT 372 BW992674
CC10359_BW992677 gSNP00095 TGCTGCCATTAAAGCTTGTC GCTGATCTCAACCTTCAGGC 373 BW992677
CC10379_BW992702 gSNP00099 AGGATTTCAACAAGATTGCGA CATTTGGGCACAGACACAAG 342 BW992702
CC10397_BW992723 gSNP00103 AAGCGTGACTTGTTGGAATG GGACAATTGGTATTGCCGTC 399 BW992723
CC10408_BW992739 gSNP00106 AGCTTCCAGAAGAAGCACCA AGCAGACTATGTTGCAGCCA 508 BW992739
CC10412_BW992743 gSNP00107 TGAAGGCAGAGATTGAGGCT CGAGAGCCCCTATTTCACAG 563 BW992743
CC10413_BW992744 gSNP00108 ATGTTAATTGGCCATCAGCC GCAAGCCTTCAGAAATGGAG 534 BW992744
CC10427_BW992760 gSNP00111 TTTTGCAAATTCACTCCTCG CGGTCCAGAAATTTGTTGCT 389 BW992760
CC10433_BW992768 gSNP00112 TTGGTTCTTTTCAGGGGGTA GACTCCTATCTGGGCCATCA 343 BW992768
CC10438_BW992773 gSNP00113 GACTAAGCCAGCCCAGTTTG CTGCAATCAGATCGCTGGTA 437 BW992773
CC10440_BW992774 gSNP00114 CTCTGACATGCAAGTTTGGC CCTCAACTGATCCTCCTCCA 568 BW992774
CC10441_BW992775 gSNP00115 AAGGCCTTGGAACTGATGAA AGCTTCTGGAAGGGTCCACT 370 BW992775
CC10445_BW992780 gSNP00117 GCCCTCACAAAAATGAGGTT GTTACAGTGCAGCATCCCCT 486 BW992780
CC10451_BW992787 gSNP00119 GAGCGAAGAGAGCCTCAAAA ATGTCAGCCTCCCTTCAAAA 389 BW992787
CC10456_BW992792 gSNP00120 TGAATCCCCAGCAGTAGAGC GCAGGAACCGGACTAGATGA 384 BW992792
CC10465_BW992803 gSNP00121 AATTGGCTGGATGATGTGTG GATTCAGCCCAGCATGATTT 379 BW992803
CC10483_BW992827 gSNP00127 CCTCAAGCTTACGAAACCCA TGCTTGATAACGGTTGGAAA 465 BW992827
CC10487_BW992831 gSNP00128 TGATCTGCTCCGTGTCACTC GAGAGCAGAGGGAGGTTTGA 403 BW992831
CC10490_BW992836 gSNP00129 AATCCAAACGCCACTTCATC AGTGCGGGGACTCCTTTTAT 481 BW992836
CC10493_BW992839 gSNP00130 CTCCGGTTTCGATGCTTAAA TAGTGGGTGGAAGCAACTCC 533 BW992839
CC10514_BW992861 gSNP00133 AATGCATGCACATGATTTGG TTGGAAATTGTTCCCGTCTC 515 BW992861
CC10523_BW992873 gSNP00135 ATTTGGTGATGCAGGCTTTC CCTGTTTTCCCAAGAACCAA 435 BW992873
CC10546_BW992896 gSNP00138 AGGACGAAACCCTTCCAGTT GCAGCTCACATACAGTGGGA 364 BW992896
CC10554_BW992907 gSNP00140 CCTCCCCTTGTCATTTTTGA CAACGGTTACCTTTTGGTGG 487 BW992907
CC10560_BW992914 gSNP00141 GCTTGCTTGAGTCTTTTCCC TTCTCTTTCATGAAGGGTTTCAA 364 BW992914
CC10565_BW992920 gSNP00142 CCAGTGGGTGTGAGATAGGAA TGCTCACTCTGGGCTATTGA 398 BW992920
CC10583_BW992944 gSNP00144 TCATAGGAATGGATGCCAGA AGCACAAATGAGATCCTTTTCA 391 BW992944
CC10588_BW992952 gSNP00146 TACCAAGCGAAATTCTCCGT ATTTTCCTCCTCCAAGCGTT 399 BW992952
CC10590_BW992954 gSNP00147 GGAGGGTCTGAGGAAGGAAC TTCAATGGCAAACACTGACC 483 BW992954
CC10618_BW992988 gSNP00152 TTGTGCTTTGCAATCCAGTC AAATCTTGTGATATGGCGGC 484 BW992988
CC10621_BW992991 gSNP00153 CCCAAAGAACCTGAAACCAA GGTGAATGTCCTCCACTGGT 424 BW992991
CC10634_BW993009 gSNP00156 CTGGATTTGGAGGTTGATGC TCAGATTTTCGCCTCCTGTT 443 BW993009
CC10646_BW993027 gSNP00158 AAAACAGCCGAGGAGTTGAA AAGTCCCAACCTGAGCCTTT 396 BW993027
CC10659_BW993046 gSNP00160 GAGGCAGCAAGTACAGGGAG GCTGATATGCCCTTCAGCTC 434 BW993046
CC10660_BW993047 gSNP00161 GGCACCATAGCTAGCAAACC TATGCACAGGAGCAGGTGTC 445 BW993047
CC10664_BW993053 gSNP00162 TCACTTGTGACTGCCCAAAG CAAGTAGGCAGTCATTCCGAG 333 BW993053
CC10679_BW993073 gSNP00164 GTGGAAGGTTGAAATCGTGG CAGACCCCTTTCAAGAAGGA 589 BW993073
CC10698_BW993099 gSNP00168 GAGGATGGGTCTCTGGATGA GTCAGCATCCCAAACCCTAA 354 BW993099
CC10704_BW993108 gSNP00169 CATTGGCCAAGACTCTCTCC GAGCATGGTTTGGAACAAGAA 554 BW993108
CC10707_BW993113 gSNP00172 GATCAAACAGAAGCCTTCGC AGATCCACTCGCTTCTCTGC 479 BW993113
CC10756_BW993171 gSNP00178 CAAGCACCCTTAAAACATCCA CTGCAGACTGGAAATGCAAA 537 BW993171
CC10760_BW993176 gSNP00180 TGGGGTGTAAACTAGCCCTG CTTCCTTCCCAGAAACTCCC 382 BW993176
CC10771_BW993188 gSNP00182 GGAAGTTCAGGAAAATGGCA TTGATCATTCTGGGTCAAAGG 517 BW993188
CC10781_BW993202 gSNP00185 AGGCAACCTTCCCTTTCAGT GGAGAACCACTTGTTGTGGC 463 BW993202
CC10803_BW993232 gSNP00194 TGTGTGTTTGGTGGGCTTTA GATACACATGTCACGTCGCC 426 BW993232
CC10881_BW993338 gSNP00204 TGCAGTCATAGGTGTGTGCAT TGGCCTGGAATGTTAAAAGC 476 BW993338
CC10886_BW993345 gSNP00205 GACAATGAAGCAGTGAGGCA CATTGCGTAGAGTTGTGGGA 532 BW993345
CC10908_BW993374 gSNP00209 AGAATTGGGCAGTTCTCCTAAA AAAAATTCATTGCCCTGGTG 465 BW993374
CC10912_BW993378 gSNP00211 ACATAATGGGCCAACGGTAA CAGCGTCATAAGTGGTGGAG 523 BW993378
CC10919_BW993388 gSNP00213 AACCAATCAATGGAAATCGAA CATGGTTTGATGCTGCAGTT 438 BW993388
CC10957_BW993429 gSNP00216 AGCAAGGATAGAGGGATGTTG GGGCTGATTTGTGCTCATTT 506 BW993429
CC10968_BW993448 gSNP00219 CCTGTTTAAATTCAGGTTTCTTCA TGTATTGTAGGGCTGAAACCAA 438 BW993448
CC11019_BW993508 gSNP00227 AATCATGCGTGTGTTTGAGC ACATAACTTGGATGGGCTGC 450 BW993508
CC11026_BW993518 gSNP00230 TGACCTGCACATTCAGAAGC ACATGCCATCCTGCAAGTCT 537 BW993518
CC11060_BW993558 gSNP00234 CAGCAGCAAATGATGACGTT TGCAAGGCGTCAAATTTAGT 383 BW993558
CC11061_BW993559 gSNP00235 CATCAAGGATGCCTTTGACTAA TGTGGCTGAAGGTATTCTTACTTG 372 BW993559
CC11080_BW993584 gSNP00236 GAGGACAACGGTGAGAGAGC ATGTGGACCAGCCACTTAGG 491 BW993584
CC11090_BW993596 gSNP00238 CAAAATTAGAGGGCAGAGCG AGGCCTGAAACTACTCGCAC 336 BW993596
CC11097_BW993606 gSNP00239 TGTAAGTGCAATCGTAACCCTTT CAGTGAGGAGTGTGAGGGGT 395 BW993606
CC11164_BW993695 gSNP00246 GTCATATAATCGCGGGGATG ACATGATGCATGAACATCGG 428 BW993695
CC11170_BW993701 gSNP00248 GCAAGTTCAGGAAAAGTGCC ACCGAGATCATGTTTCCCAG 537 BW993701
CC11176_BW993708 gSNP00250 TGGAAAGGAAAACAGGGTGT CCTCTCCTACTCAAGCCCCT 386 BW993708
CC11192_BW993728 gSNP00252 AACAGTGCGAACAACACTGC AGGGTTCTTTACCTCGCCAT 443 BW993728
CC11195_BW993731 gSNP00253 TGGGTGTTTGTTTTTGCTGA CCAGATTATAGCGGTCCCAA 332 BW993731
CC11207_BW993745 gSNP00256 GTACCTTGACAGGCCGTGAT TGCAGATCTAGGGTTTGGCT 401 BW993745
CC11285_BW993842 gSNP00261 GTTACAAGACTCCCCAGGCA AGTCAAGCGCCTTCTATCCA 492 BW993842
CC11287_BW993844 gSNP00263 AGATGCTCTCTGAGACCCGA CCTCTAAGTGGACACGGGAA 402 BW993844
CC11314_BW993875 gSNP00268 CAACAAGCTACGGCTGATGA TTCCAATTTCCAGCAGCTTT 493 BW993875
CC11316_BW993878 gSNP00269 TGCAGGTTCTGGCATAAATTC GATGCTGACGGGAAGAAGAG 404 BW993878
CC11326_BW993891 gSNP00271 AAAAGTTTTCTGGTCGCCAA TGTCAACTTCGATTGCTGCT 467 BW993891
CC12129_DC429890 gSNP00279 AGGGCGTGTATGAGATTTGG CAAATTGCAGTCTGTGAGGG 503 DC429890
CC12157_DC429913 gSNP00281 AAGCATAAATTTTGGCGCAG CCTTGTCCCCACAAATCAGA 493 DC429913
CC12178_DC429930 gSNP00283 GACACAATTTCCTTTCCCGA GTGGCCTGCTCAAAAATCTC 490 DC429930
CC12195_DC429943 gSNP00285 TTGTTGTTTCTGCCTGGATCT TCCCAGCTGTAGAAGACCGT 560 DC429943
CC12296_DC430034 gSNP00299 CGGTAGGGGAAACAATTTCA AATTTGGCACTGCTTCTTGG 505 DC430034
CC12412_DC430138 gSNP00312 ACATTTCAAAACTCCCGCAC ATGTCAAGCTTGTTCCCACC 468 DC430138
CC12483_DC430198 gSNP00315 ATTGTTGAGCCGGTTGTTCT TTCTGTGATCCCATCTGCAA 433 DC430198
CC12508_DC430214 gSNP00318 TTCATTATGGAATGGTGGCA GCAGGAAGACAGAATTCCCA 331 DC430214
CC12538_DC430235 gSNP00321 ACTCTCGTCTGGCCTGGATA AAAGAGGTGCTTTGGGTGTG 457 DC430235
CC12603_DC430295 gSNP00330 GTGGGAATCGGAACAAGAAA CATAAGGAGCCTCTGGGTCA 496 DC430295
CC12615_DC430304 gSNP00332 ATTCAGCTTGACCTGGTTGC AGTCTCGATCTCGTGGAACG 522 DC430304
CC12685_DC430365 gSNP00335 GGATTGATAGGTTGGGGGAT ATAATTCGACGAGGTGGCTG 486 DC430365
CC12730_DC430396 gSNP00338 CTGAAACGCCCCTGTACATT ACTTCGGCTCACAGATGCTT 344 DC430396
CC12758_DC430422 gSNP00341 TCGAACCATCTTTTACCCGA AAAGTGTCCGCGTCTTCAA 526 DC430422
CC12814_DC430452 gSNP00344 TGCCCGGATATCCCTTAAAT AAGCCTGCAGAGACTCCTTG 411 DC430452
CC12915_DC430519 gSNP00346 ATTTAGCATGGCCACTGAGG TTGTGCACCGTACTTTCGAG 486 DC430519
CC13006_DC430561 gSNP00350 CCATGATGTTTCCTGCCATA TGACGAGCCTGTTGTAATCG 329 DC430561
CC1311_AU084402 gSNP00361 GAACTGATTCCGCCCTGTTA TGGCAGCAATTCCATAGC 396 AU084402
CC13142_DC430672 gSNP00363 CATTGGCCTTTTCCACAATC TGTGCAACAATGGTGAACCT 318 DC430672
CC13322_DC430828 gSNP00379 GATTGGGGTCTGCATAGGTC CCTCTCATTGGTGGCAGATT 300 DC430828
CC1332_AU084419 gSNP00380 AACCAAAGAGTGCGTCCATC TTCATTTTCATCGCCATCAG 320 AU084419
CC13342_DC430846 gSNP00381 CAGAGTGGGGATGAAAAGGA CCACATCAGCTTTGAACGAG 343 DC430846
CC13627_DC431098 gSNP00399 GATCAAATTGAGCGGTTTCG GCGCAGTAAGAAGAGCCATT 416 DC431098
CC13930_DC431360 gSNP00409 ACACAGATAGGATGAGCCGC TCTGAGAAGGCCCTCGTATG 381 DC431360
CC13978_DC431397 gSNP00414 CTGGTCGACAGTTCGAATCA ACCCTGGACAAAGGACACAG 300 DC431397
CC1401_AU084477 gSNP00415 GGCATTAAATATTGAGGAACGG ATGCAGCAGGATAACTGCCT 354 AU084477
CC1476_AU084537 gSNP00426 ACTCTGGAGGAGGTGCAAAA CCTCAAGAGTCATCTCCCCA 361 AU084537
CC15017_DC432170 gSNP00428 CAGTGTTGGCTTCATCGAAA GCGTACGCAACCTCTCTTCT 369 DC432170
CC1507_AU084562 gSNP00430 TTCTGCATATCAATAGGGATGG CACACCCAAAAGTAGGGGAA 328 AU084562
CC1519_AU084571 gSNP00438 CATTTGGAGCAGCAATGAGA TTCTGCCAAACAAACAAGCA 334 AU084571
CC15297_DC432350 gSNP00440 GAATCCTTGCAATTAGGGCA ATCCCTTGTGCAGCAAGTTT 376 DC432350
CC15365_DC432413 gSNP00443 AGCGAAGGCTTTTTCATTCA TGAAAGGGCTGGTGTCTTCT 468 DC432413
CC15385_DC432424 gSNP00444 GCAACCGAATAGCTGAAAGG ATGACCGAACTCCACGATGT 308 DC432424
CC15434_DC432461 gSNP00449 CTGCGATCCCAAAGAAGAAA ACATCTGATCCAACGAAGGC 328 DC432461
CC15509_DC432512 gSNP00452 ATTCATTTGAGGCCAAGGCT CCACATCCACTGAGAGCAAA 422 DC432512
CC15522_DC432523 gSNP00453 TTGTCGTTTGCCACATGAAT CATAACGATAGTCCCCTGGC 300 DC432523
CC15631_DC432611 gSNP00464 TCGACAAAAGGAGGTCAAATG TTCTTTTCCTGTGCCATTCC 479 DC432611
CC15754_DC432705 gSNP00474 TGCTCCACCTCCTTTTTCAT ATGTCATCCCACATCCCTGT 341 DC432705
CC15788_DC432724 gSNP00477 TCGTGTCAACGCCAACAATA TAACGGCTTGAAAGTACGCC 325 DC432724
CC15840_DC432764 gSNP00483 GTTGCTTTGTATAGCGGGGA ATTTCCATTCCCATCGTCC 328 DC432764
CC1664_AU084661 gSNP00485 GCAACATGCTTTGAACCAAAT ACCAAAAGGAAGTGCAATCG 324 AU084661
CC1780_AU084757 gSNP00492 CCTTTAACATTTTGCGGGAA GACGCAAGGGCAACATTATT 356 AU084757
CC1801_AU084775 gSNP00493 CTTGGGATGCCTCAAAACAT CGGCACAGAAGATTACAGAGC 334 AU084775
CC1814_AU084788 gSNP00494 CTGTGCCATGGACTGAAGAA GTGATCACCGCCTCTCAGAT 326 AU084788
CC1854_AU084818 gSNP00496 GAGATAACAGGGGGTGGAGG TGCCCATACTGTTGCTCAAA 334 AU084818
CC1953_AU084902 gSNP00501 CAAGATGAGGGATTAGGCCA TGACCTGGGTTTTCCTGATA 381 AU084902
CC2006_AU084940 gSNP00502 AGAGAAGCAATCAAATGGGC CTTGGGAGCATTGGAAAGAG 338 AU084940
CC2023_AU084952 gSNP00504 CGGACACATTGTCTTGCATC TCATTGGGAAACCAGACACC 340 AU084952
CC2035_AU084958 gSNP00505 ATTAGCGGCGAAGATGAAGA TGCAACACTTTTTGACCAGC 330 AU084958
CC2036_AU084959 gSNP00506 GCAGTGAAGTGTTGTTAGTTGTTG AAAGGTGGGCAGCAAAATC 336 AU084959
CC2041_AU084963 gSNP00507 ACAAACAAAACGGTCGGAAG ATGGAGGGAATGGTGTTCAG 350 AU084963
CC2086_AU085004 gSNP00512 AGAGCTCTGTAGCAGGGCAA AAAAGCCCTTTCCACCAAAG 338 AU085004
CC2088_AU085006 gSNP00513 TGGACCTCAATCACTTGCAC TCTGCTTTTTACGCCGTTCT 344 AU085006
CC2343_AU085180 gSNP00517 CGGCCAAGGAAAATGAGATA CAAAGCTGGGATACCCTCTG 328 AU085180
CC2346_AU085182 gSNP00518 CCTTGCCTCTGATCTTCTCG TGGTAGCTTTACCATCCCCA 329 AU085182
CC2518_AU085307 gSNP00525 AAGGTTTGGCATGAATCTCG ATTCTGGCCGGTACAGATTG 371 AU085307
CC2564_AU085343 gSNP00528 TTTTCCCCCATAAAAATCCC CACGTACAGTGACACCCCTG 345 AU085343
CC2634_AU085402 gSNP00530 TGGCTATAACATTGGCCAGG TGCAGCAACTGCAGAGACAT 374 AU085402
CC2647_AU085413 gSNP00531 TCCGCAGCACATTGATACTC TGATACTGCAAGGCAAGTCG 344 AU085413
CC3065F_BP175568 gSNP00542 TCCTCAAGGCATTAGCCAAC GTCGTTCCAGGCAAAGAAAG 439 BP175568
CC3097F_BP175588 gSNP00546 TGAAAGCTCACGGTATGGAG CTCCCTCATCATGGTCCTGT 356 BP175588
CC3414F_BP175768 gSNP00552 ATGATGTTCCTGCCGTTAGC CCGCAAAAAGCTCCAAAATA 388 BP175768
CC3815F_BP175907 gSNP00555 CGGAGGAAGATGAGAACAGC GCTCCCGCTGAGAATGTAGA 302 BP175907
CC4032F_BP176048 gSNP00563 CTACAGGGAAGCGATTCAGG TGACCAGGAATTAAGCCAAAA 330 BP176048
CC4118F_BP176096 gSNP00566 AAGACCAAATGGTGTCCTGC ATGTTCTGACCATGCACCAA 333 BP176096
CC4129F_BP176106 gSNP00567 TGAACCATGGATTGAAAAGGA TTGTAGCCTGGCTTCTCGAT 341 BP176106
CC4239F_BP176159 gSNP00570 TGGAAGTTAACTCATGGGGAA CCCCAAGTCCAGCACTACTC 406 BP176159
CC4275F_BP176180 gSNP00573 TATGATGCAATCCCAGAGCA TGAGCTGACCTGTACTCCCC 398 BP176180
CC4342F_BP176231 gSNP00575 GGGAGTTCCTTAAACGGTCA TGTCATTGAAAGATGACATCCA 404 BP176231
CC4402F_BP176274 gSNP00581 TTTCGTGTCTTTTATTTTCTGGG CCAATCAACATTTTCCCGTC 305 BP176274
CC4552F_BP176369 gSNP00582 GCCATTCAATAAGACGCTCC TCTGAAGTTGGTCGAGGGAA 359 BP176369
CC4710F_BP176449 gSNP00585 TCTGGCTCTTAAGGAAGGGG ATTGCTGCATCAGTTTCACG 327 BP176449
CC4715F_BP176455 gSNP00586 TTTGAGGGACAATGGAAACC CCCAAACCATCTTCCCTCTT 326 BP176455
CC4810F_BP176524 gSNP00589 CCCCGAAGATCAAAATCAGA CGCCATTCTTTCTCACCAAT 399 BP176524
CC4918F_BP176592 gSNP00590 TTCCCCACAGGAACAATTTC AAGAGTTCACTCCAAGCCCA 323 BP176592
CD0355_AU036746 gSNP00594 TGGTCCATTCAATTGGGTTT CCCTGCAGAAGCATAAATGG 350 AU036746
CD0423_AU036749 gSNP00595 CTTCAAGCCTGGTCCTGTTC ATTTCAAGCCTCTGCTTCCA 361 AU036749
CD1120_AU036808 gSNP00597 GTCCTCATGTCAGTGGGCTT TGAGATTCCCAAGCTTCGAC 343 AU036808
CD1274_AU036826 gSNP00602 ACCCATCTCGACAGTCTGGT ATCCAAACAGGAACGCCC 514 AU036826
CF0535_AU299774 gSNP00624 GTCCCCTTTGAGCAGTTCAG AGGAGGCTGAGAGACACCAA 381 AU299774
CF0541_AU299777 gSNP00626 TGTTGAAGTGTGACCGTTCTG GACTTGGACATGGCTATCCC 345 AU299777
CF0559_AU299793 gSNP00627 TCTGAGCAGGAATAACCCAAA TGCAATCTCCTCAATTAAAACG 351 AU299793
CF0573_AU299805 gSNP00634 GAAATCTGCCCAGTTGCAATA CAACCACGCATAAAGCTCCT 317 AU299805
CF0678_AU299888 gSNP00651 GGAATCAGGGGGAGCTTAAA TGAACTGCCAACTCATCACA 337 AU299888
CF0727_AU299928 gSNP00657 TAAGTTGGGGCCATTTCAAG GGATGGGAGCCTCTATTTCTG 511 AU299928
CF0737_AU299932 gSNP00658 CGATGAGCAGATTGCTTTCA CAGTTTGCCACGTTTTGTTG 456 AU299932
CF0739_AU299934 gSNP00659 GCTTCGGTGTTGTACTTTTGG TCATTGTTCATCCCCTCCAT 453 AU299934
CF0740_AU299935 gSNP00660 AAGCTGCCAAATGGAGTGAC ATGTGGGGATGCTCAAAAAG 392 AU299935
CF0742_AU299937 gSNP00661 TTTGTAAACAGGGAGTGCCC ATCCCCATGATCAAGCAAAA 397 AU299937
CF0748_AU299940 gSNP00662 ACTAGTGGTCACGCAGAGGC AAAATGGCCTCCATAAGGGT 410 AU299940
CF0754_AU299945 gSNP00663 TGCAAAGAATTTGATGCTGG TCATCAAGCCTGTTTGACCTT 404 AU299945
CF0756_AU299947 gSNP00665 AATCCAAATTTGCCAGTGCT GTCATCCACGTCCCCATACT 407 AU299947
CF0765_AU299955 gSNP00669 AGCGCATTCTTTGCAACTTT TCTCGAAGCAGTTGATAGCG 430 AU299955
CF0773_AU299956 gSNP00670 CTCGACCTGATACCATTGAGA TTCGGAGAGCTCTTTGACAAT 462 AU299956
CF0841_AU299990 gSNP00674 TCCATCAGCTTAAAATGCCC AATGCCATGTTTTCATGGAG 399 AU299990
CF0877_AU300007 gSNP00678 GGGATAAAGCATTGCGGTAA TAACAGAATCCCAGGGCAAC 457 AU300007
CF0882_AU300010 gSNP00679 CTAGGCAACTGGCCTTTCTG TCAACTGGGCCTATTTCTATATCC 468 AU300010
CF0904_AU300026 gSNP00682 TTGAAAGCATGTTGTGAGGC TTCATCTTCATTTTCTTCATTTATGC 492 AU300026
CF0905_AU300027 gSNP00683 TCCAATCTGAGAGCATTTTTCA CTTATAGATGGTGGTGCTGGC 409 AU300027
CF0910_AU300032 gSNP00685 CATCACTTCATTCCAATCTTTTCA ATGTCCCTTTGTGTGAATGC 462 AU300032
CF0931_AU300048 gSNP00686 GGTCAGCGTCAACAGGTTTT TGGCATAAGCAGTGAATTACATTT 378 AU300048
CF0950_AU300065 gSNP00689 AAACCATGTTCATGCAGCAG GGCTCCCTCAGTTTTCTCCT 415 AU300065
CF0962_AU300076 gSNP00691 GGTGCAAGTATTGCCATCAA ACAGCAGCAGCACGTACAAT 422 AU300076
CF0973_AU300084 gSNP00695 CAGCTAAACTCATGCGGCTT GGAAGCTGTCCTTTCTTGTTAGC 361 AU300084
CF0977_AU300086 gSNP00696 CCTTTCGTCAAGGTTTTGGA ATGCTGCATTCACCTCCTCT 307 AU300086
CF1014_AU300117 gSNP00701 AAGCAGAAACAGCGTCCACT ACAAAGGTCCCCACATGGTA 446 AU300117
CF1044_AU300144 gSNP00706 TGTCATTGGATGGTGGAATG CAGAGCATAAGCCACGTTGA 411 AU300144
CF1050_AU300150 gSNP00707 GGTGGAAGAGAAGAAAGGCA CCCAATGCGAGTTTGTTCTT 439 AU300150
CF1082_AU300176 gSNP00712 TTCTCACACGGCACACTCTC GAGGGCATATGTAATCAGCCA 448 AU300176
CF1091_AU300181 gSNP00714 GTGCAGGCCACATAGATCCT GCTACGACAGGGCTCTTCAC 469 AU300181
CF1102_AU300190 gSNP00717 AGCAGCGAACTGGTCTTAGC CCGTTTGTCTTTCCTTCTTTG 498 AU300190
CF1103_AU300191 gSNP00718 AAACCAAACAACCAACCCAA CCAAAGTCAGGGTGGTTTGA 410 AU300191
CF1117_AU300203 gSNP00721 TGAAAGTTGTTTTCAGGGTAGGA TCGGCCTCAAACAATCTTCT 312 AU300203
CF1129_AU300210 gSNP00723 ACTGAGAGCTGCAGGAGAGG TATAATGCCCCGAATCCTCA 380 AU300210
CF1136_AU300217 gSNP00724 AAGGCGAAGGGTACAGATCA ATCTGCCTTCTCTGCCAAAA 396 AU300217
CF1138_AU300218 gSNP00725 TCGTCCAACATCTTTGGCA ATGAAAGCTCATTGGCCGTA 313 AU300218
CF1161_AU300233 gSNP00729 GGCGATTTAAGTCTGTATCGTG CAAGAGCTGCACAATGCTGT 430 AU300233
CF1179_AU300249 gSNP00731 ATGTGATTGGCATTGACGAA CACATGTTTACCCAACAGCCT 396 AU300249
CF1206_AU300267 gSNP00738 CAAAAAGCACGCACTGTGA GGTCAGAAAGCTGGATTTGC 368 AU300267
CF1239_AU300291 gSNP00740 CTGCTTGTGAATGATGGTGC TGCAAAATGTACCGAGCAAG 410 AU300291
CM0034_AU298747 gSNP00746 GATGTTGTTGTGAAGGCACG CAGACCTTGTCGAAGCACAA 393 AU298747
CM0037_AU298751 gSNP00747 TGGTCAAGGAAGTGCTGACA GAGTGGCCCTAAAAATGCAA 448 AU298751
CM0051_AU298769 gSNP00748 AATTTTGCAGCACCTCGAAT CCCGTGCTCTTATTACCCAA 389 AU298769
CM0066_AU298788 gSNP00750 ACCGTGTGGAAAACATGGAT TCAAGTGGCCAAGATTGAAA 383 AU298788
CM0112_AU298845 gSNP00754 ACTGCAAGAAGATTGGCTGC CACTTGGTTGATGTGCTTTGA 372 AU298845
CM0116_AU298851 gSNP00755 GATGAAGAAGGAGGGGAAGG TTGGACTGCTTCAGCACACT 380 AU298851
CM0160_AU298898 gSNP00757 GTCTTGCAAGGTCAAGAGGC TGCAAGTCTGTCCCTGATGT 338 AU298898
CM0191_AU298933 gSNP00760 TGACTGGCTTGGATGATGTT ATTGAAACCATTTCTGCGCT 343 AU298933
CM0606_AU299118 gSNP00778 CGATTGGTAAGATCCTAGAAGGC AAAAGGACTAGCAAACTTTGGA 359 AU299118
CM0729_AU299225 gSNP00799 CTGCAGTGGACTGTGTGGAT CACAAACTGCATCTTGCTTGA 444 AU299225
CM0741_AU299237 gSNP00801 ATAGTCCAAGGCGTTTGCAG CTGCTGTTACAAGAACGCCA 436 AU299237
CM0762_AU299256 gSNP00803 GAAACCGCTCAGAGAGTTCG TCCTTTCCTGTCAAAAACCG 393 AU299256
CM0769_AU299263 gSNP00805 GTGGTAGCACACAGCCTTCA CTGCCACCACTACTTGCAGA 484 AU299263
CM0788_AU299281 gSNP00808 TGATTCACGAGGGGGTTAAG AAGCACAAATGGGGTCAATC 459 AU299281
CM0791_AU299283 gSNP00809 TGTTGGAGATGGGTTTGGTT TTGGCAAGACAACATGAAGC 407 AU299283
CM0802_AU299293 gSNP00810 AGGAAAGCGAGAACACATGG TAGTCTTGTTCGGGCAATGG 423 AU299293
CM0812_AU299301 gSNP00815 TCCTGGTGCTCACAGTTTCA ATTCGACAGAGGAAAGCGAA 506 AU299301
CM0818_AU299307 gSNP00818 CTTTTGTTTTGTGCGTTTCG AAAACAGATCTGCCTCACCC 431 AU299307
CM0887_AU299370 gSNP00830 TTGAAAGAAGGGTTTACGGC CTTTCTTGCTCTCCTGGCTG 503 AU299370
CM0888_AU299371 gSNP00831 TGTGTCTTGAAGGACTCGAGAA AGCACCATCCAAAAACCAAG 437 AU299371
CM0900_AU299383 gSNP00834 AATTTTGTCATGCCCTGGAG TCCTGCTGTTCCCAAGAGAT 495 AU299383
CM0914_AU299397 gSNP00839 ACTCATTCCATTCCCGTGAG GCCCAAGAATTCAAAGTCCA 474 AU299397
CM0939_AU299421 gSNP00844 TGAAGAGTACACGTGCAGGG TTTTTCATCCCTCAGCTTGG 460 AU299421
CM0940_AU299422 gSNP00845 GGCTTCTACAGCTTTGCAGG CGAGGCGGGGAACTTTTC 517 AU299422
CM0955_AU299435 gSNP00847 ATTTGTGGATGGGAGACTGC CTTTGGTTTCCAAGACCTGC 490 AU299435
CM0961_AU299441 gSNP00849 GGTAGAATGCAAGCTCCCCT TGCACTCAATTTCAAGGTTCC 448 AU299441
CM0969_AU299448 gSNP00851 CGTCTAATTTCGAAACCCCA CAGTTGCCATAATTGGCGTA 334 AU299448
CM0984_AU299463 gSNP00852 TATGGAGGATGATCCCGAAC GCGGATCGCTGTAATTATCC 350 AU299463
CM0994_AU299473 gSNP00855 ATTGGATTTGGCAACAGAGC CCCCATTCCATGACTACCAT 358 AU299473
CM0997_AU299476 gSNP00856 AGAACCAACGAACACGCTCT CTCTTCATCGGGATGTGGTT 497 AU299476
CM0998_AU299477 gSNP00857 TTTGATGATATGGCCGAGTG TGATAAATGCGCCTGCTATG 561 AU299477
CM1012_AU299491 gSNP00859 ATGAGTGCTCAAAGGCCAAT GAGAGGTGCCCTTCTGTGAG 465 AU299491
CM1018_AU299496 gSNP00860 GAGTCGGCGATTCGTATTGT TGTATACCAATTGCACCTTTTCA 334 AU299496
CM1032_AU299509 gSNP00862 CCAACACTGCTCATTCAGAGA AACCACACTTATAAGAAGTTCCAGTG 401 AU299509
CMFL001_D01_F gSNP00869 tagcaaagcaggagatgcaa agaccaccaaatacatgccc 419 BY877960
CMFL001_E04_F gSNP00871 ttgctgaaaaacattcaccg ccatcctcatcacactccct 419 BY877985
CMFL001_H17_F gSNP00879 acacaagagccacccaaaag ggccattcaccagagtaagg 358 BY878063
CMFL001_H24_F gSNP00881 gcgggtccttgtaacaactc actccccactctgagacgaa 487 BY878070
CMFL001_I01_F gSNP00882 gcgcaccctttgtttatcat agcctggcctcattatcatc 439 BY878071
CMFL001_I18_F gSNP00885 ttgaacaatgttgtctggacg gtaagttcacgcctgggaaa 354 BY878086
CMFL001_K10_F gSNP00890 aatgagaatgatgggcttgg tcagtgcgaaacacaaggag 483 BY878122
CMFL001_L10_F gSNP00892 atccttcctgcgtgattttg tccaaccatgttggtcattg 475 BY878142
CMFL001_L17_F gSNP00895 agggcattaagcaacgtgat tgatagtgcgaattgccttg 402 BY878148
CMFL001_L22_F gSNP00896 aatcagcatcacccacatga gagtttccaatccaacccaa 473 BY878153
CMFL001_M16_F gSNP00897 acgagtcgacgataattggc accccttgtcacatccaaga 378 BY878170
CMFL001_N06_F gSNP00898 tgtcctgtttttagcaggatga ggtcttcaaaaacctgcacc 423 BY878184
CMFL001_N17_F gSNP00899 gagaggcgatttgttgaagc cgaatcctgttccattgtca 374 BY878195
CMFL001_N18_F gSNP00900 tatgcttgggcgtatgaaca gggcacaataatagaagcgg 443 BY878196
CMFL001_P06_F gSNP00907 acatgcttttcctccttagaga aagtgcatgaaaggggtcat 405 BY878232
CMFL001_P17_F gSNP00909 atggatagcaatcgctttgg tgcaactgcacagtgtttca 421 BY878242
CMFL002_A05_F gSNP00910 gtcactgtgcacgcagtttt gcaaaagtctgacacgatgc 354 BY878253
CMFL002_A22_F gSNP00913 cagccagagaaagcaaattgt tccttctccatgatcatctgc 412 BY878266
CMFL002_A23_F gSNP00914 agcccatgctggtatgatgt tcattttgcacacgtggatt 434 BY878267
CMFL002_B19_F gSNP00915 tgaagcaccagtattgggaa tgagtgttaaggcagagggc 371 BY878283
CMFL002_E17_F gSNP00920 gcagataggctttctcaaccc tccatcgccaaaaacacac 361 BY878348
CMFL002_E18_F gSNP00921 ttgaacatggagcaagcaag ggaggcagtctgtccttcag 335 BY878349
CMFL002_F15_F gSNP00922 ggtaactgcatcggaaggaa agcagcaagatagcgaaagc 464 BY878367
CMFL002_F17_F gSNP00923 gagagtggcttcaattgcct tagacaggtactgcgcatgg 324 BY878369
CMFL002_G13_F gSNP00925 tcagagatcgaatggggttc agctgagtcacaagcactgg 470 BY878389
CMFL002_H03_F gSNP00927 tagttatgcacagcatgggg ggacttaaatgcaactgcca 453 BY878403
CMFL002_J13_F gSNP00933 caggtttgggaaatctggaa aggaaaggtggaaacaatgc 357 BY878457
CMFL002_K19_F gSNP00936 gcctccaaaagtgtggctta tccagcgtaaccacaagaga 390 BY878486
CMFL002_M19_F gSNP00943 ccttcatcaacgcaggaaat ggggatcagtggagctaaaa 360 BY878533
CMFL002_M21_F gSNP00944 gttgggaggaattttacgca cttctccagagcgtcagctt 400 BY878535
CMFL002_M22_F gSNP00945 tatacacggcgactttgctg ggaagaaggatctgtgcagg 396 BY878536
CMFL002_O03_F gSNP00949 aaaagctggatcagttttctgc tggtaatggcgcactgtaaa 404 BY878564
CMFL002_O08_F gSNP00951 atgctgggctatgaatgtcc ttgatgcttgaatatgtggga 436 BY878569
CMFL002_O13_F gSNP00952 atagctgtggtgggagatcg cgttaccccatgatcaatcc 381 BY878574
CMFL002_O18_F gSNP00953 gggattagcagcccacatta gaatggtacctgcccctttt 442 BY878577
CMFL002_P18_F gSNP00959 ttgagaagcatagtcagagagca taattgaacttggcgggatt 311 BY878601
CMFL002_P21_F gSNP00960 ttgatccagattcagcttgc accacgcaccgaaaattaag 449 BY878604
CMFL003_B09_F gSNP00964 tctgctaagtggaagccgat catcttctgctgacccaaca 414 BY878639
CMFL003_B23_F gSNP00967 atcaggagcagcactggaat tcactgagatgaccaccatga 379 BY878653
CMFL003_C13_F gSNP00971 acaacattccctcgatctgc tcatgggtttggattcgttt 437 BY878667
CMFL003_D03_F gSNP00973 acacaatgaaggggttctgc ggttgtcctcgaaaatctgg 397 BY878680
CMFL003_D11_F gSNP00974 cggaggcggtatatacgaga gcccgactctctgcttgtag 384 BY878688
CMFL003_E13_F gSNP00979 tggattggtcaggtgggtat ggttaaccttcttgggccat 453 BY878713
CMFL003_F21_F gSNP00984 aaaggaggtgatgctttgga ccaaccagaatttctttccc 356 BY878744
CMFL003_H09_F gSNP00987 cgagtttcgaaaattccctg ctcctcttccacctgcagac 454 BY878771
CMFL003_H12_F gSNP00988 gtggagttgaacacttgggg ttgccctagaggagttgtcc 358 BY878774
CMFL003_J15_F gSNP00994 attccagacaccacgggtta cggttcatctctgtgctcaa 456 BY878817
CMFL003_K05_F gSNP00996 cgccttctgtagaacaatcattt cgggaaaacatacggaccta 319 BY878831
CMFL003_L10_F gSNP01001 ttcataggcacgagttcttga ttgctgatatcaaccaaattca 493 BY878859
CMFL003_M07_F gSNP01003 tttcacagcgcgaagaaata gaaatggtggaatctgtgcc 437 BY878877
CMFL003_P16_F gSNP01012 cggttggcttcagtcaattt acagagttcgccgagagaag 403 BY878949
CMFL004_A15_F gSNP01014 tgtgctttgagtcggtgtatg gcctttttctggtttgtgga 475 BY878968
CMFL004_B06_F gSNP01017 atcctggattttgccttcct caggataaacccgctgatgt 469 BY878983
CMFL004_B10_F gSNP01019 acgagttggttattggcacc ggggagtcctctccttcatc 459 BY878987
CMFL004_B18_F gSNP01022 cgagcttagcttcggaactg ctcaatggtgctgctgctta 478 BY878995
CMFL004_C05_F gSNP01023 attctctgcgaaatggcatc atcatccggcaattcaagag 441 BY879006
CMFL004_C10_F gSNP01024 caagaagattctttgcctatttca taatggcctgcaggtttctc 468 BY879011
CMFL004_C16_F gSNP01025 gccagcttcgattgattcat ccatgtaacacgctgtcctg 470 BY879017
CMFL004_C24_F gSNP01026 cagagggctttggaatcagt cagggacctgatcaccgata 537 BY879025
CMFL004_D03_F gSNP01027 cgtttcattctctgctctgaag tgttggtacccttgttgcac 421 BY879028
CMFL004_D11_F gSNP01029 caagattccggagattccaa ggccatgtacccaagaagaa 447 BY879036
CMFL004_D18_F gSNP01031 tcatcgacatcccacttcaa ttccacctccttggtactgc 516 BY879043
CMFL004_F03_F gSNP01037 gatctcttggtgggtggaaa agcaccaaccctgattatgc 465 BY879075
CMFL004_G03_F gSNP01039 ggtttgtgtctgcgtttgtg ggcttcttttcgtgggataa 494 BY879099
CMFL004_H16_F gSNP01041 ttctttttcccctgcatcac attgaccacgaccctgaaat 478 BY879134
CMFL004_H17_F gSNP01042 tctgcttcgattcactgcac ttgtccggaaaataaaaccg 491 BY879135
CMFL004_H18_F gSNP01043 aaaggtgggggttttcaagt aggctcatgcaaaaactgct 487 BY879136
CMFL004_I16_F gSNP01044 ttcacctggcttcttcgtct tcagagtcactggaaggagga 521 BY879156
CMFL004_J04_F gSNP01046 ttgttacaccaaaggttgcag ttcatgctgggtttttcctc 526 BY879168
CMFL004_J07_F gSNP01047 ttcgaggactgcaatttcct gggttcccacaatgagaatg 482 BY879171
CMFL004_J21_F gSNP01049 ccagcggtactcgtgaaaat ctgcagaagcgcctgtaagt 497 BY879184
CMFL004_L18_F gSNP01057 ctttgaaggatgggggaac cagggtgcctaagcttcatc 445 BY879227
CMFL004_O02_F gSNP01061 catggcatgaatttcgtttg tgtgtgagtttctgaatcaacg 466 BY879280
CMFL004_O20_F gSNP01065 ttctgccaagcaatcaacag ttcacggtcagcatctgaag 386 BY879296
CMFL004_P20_F gSNP01070 cgcataagtttcggatcacc tcttgtaggggattgaaccg 467 BY879320
CMFL005_A09_F gSNP01071 cagcaggctagggtttcaag catagtccgtttcccatgct 472 BY879333
CMFL005_A17_F gSNP01072 acagagcagaggcagagagc gcccaccgaaaaatatcaaa 450 BY879341
CMFL005_D08_F gSNP01079 ctgacagctgagttttgcga tcaagagacgaattcccagc 425 BY879401
CMFL005_D18_F gSNP01081 cgtgcaagcatcagagaaga agcttgcgaatactgcaaca 380 BY879411
CMFL005_E08_F gSNP01082 attcatgtagttgtggtgccc gatccagattagggctaaaggc 301 BY879423
CMFL005_F05_F gSNP01087 gcgagcagcagttttacaga gcttggagttgaaggtcagc 389 BY879442
CMFL005_F09_F gSNP01088 gaagctctaaatgggggagg tcgcaattggaatatagggg 417 BY879446
CMFL005_H19_F gSNP01090 ctggggccttattgagttcc acgatcaggtattggtggga 443 BY879499
CMFL005_I11_F gSNP01091 cctttgaatgcaaactgtggt cagtcacagttacagagaaggct 410 BY879514
CMFL005_I19_F gSNP01092 gagtccatgcaccagcatta ccatccggattggatgttac 442 BY879522
CMFL005_K12_F gSNP01096 cccgaatatgttatgggtgc acaaatctgttggcctctgg 424 BY879562
CMFL005_K18_F gSNP01098 agataacaccagccagtcgc gcccaaacaccactaccatt 485 BY879568
CMFL005_L02_F gSNP01101 gattacagtggtgcaagggg cttctgccatggatggtgt 302 BY879576
CMFL005_N10_F gSNP01107 atttttgagccttatgcccc aggttttcttcctcaaagcg 312 BY879631
CMFL005_N16_F gSNP01108 gaaaaatcatgaaggcgctg ctcccagtccttcacctcag 338 BY879637
CMFL005_O12_F gSNP01111 cacttgagccatttttcttgg agaagcagcaggagcaaaaa 308 BY879657
CMFL005_O22_F gSNP01112 aagtttccaattgtgtgccc cgagggcaatgcttatgact 430 BY879667
CMFL005_P14_F gSNP01113 ataagagccaccttccccac ttatgattaacccccggtca 356 BY879682
CMFL006_A08_F gSNP01116 ccaaagtggacgatagggaa gagggcagcaaaccttcata 490 BY879699
CMFL006_C05_F gSNP01122 gatgcaagcattggtctgaa tacttgccagggcagttttt 381 BY879743
CMFL006_C20_F gSNP01126 aagaccgagctggcataaaa tgcagtgaacagcctagacg 487 BY879757
CMFL006_C24_F gSNP01127 acctttttcccaacaggagc ggttgaactgttgaggcgat 528 BY879760
CMFL006_H05_F gSNP01138 taaacgcttggagtgtgctg cacccacatttgccaacata 457 BY879856
CMFL006_L19_F gSNP01151 ctgcttcctttctcattcgg agcccaaaacagcatctcat 464 BY879962
CMFL006_L24_F gSNP01152 ctggtcaattgctccatgtg caatgaattggattttgggg 396 BY879967
CMFL006_M04_F gSNP01154 gcagtccaatttgaagcaca tccatccaaaacactcaaagg 539 BY879971
CMFL006_M08_F gSNP01155 ttttctttggcttctgggtg aaagtcggcttgtggaacat 434 BY879975
CMFL006_M13_F gSNP01156 cgggaactgtgatgaaggac acaacggcactgaataggct 448 BY879980
CMFL006_M15_F gSNP01157 gccgcatttaaaaggttgaa ttgggtggaaaacagtcctc 433 BY879982
CMFL006_N09_F gSNP01159 gcgaaggccactgtatcttc cattgggagctttagcagga 506 BY880000
CMFL006_O19_F gSNP01166 tagttgcagacagtccgtgg atgcagagcggctattgttt 463 BY880034
CMFL006_P06_F gSNP01169 agcagagatcagagacccca tcataacaaggcaacccaca 426 BY880045
CMFL006_P07_F gSNP01170 tccccaacaacttcacacaa atgccatcttaatgcaagcc 479 BY880046
CMFL007_A10_F gSNP01172 ttgggctccagcaaactatt tgttcttgatccccaacaca 463 BY880071
CMFL007_B09_F gSNP01174 aaacaatctcaatcacgccc gtcgaactggaactggtggt 445 BY880094
CMFL007_B21_F gSNP01179 ggtgggaaggaaaggtctgt ttaaaagggaaagaccgagaa 413 BY880106
CMFL007_C03_F gSNP01180 ccatcattgaacttgaacgc ttgtgggcacataccaaaga 414 BY880112
CMFL007_C19_F gSNP01182 aaatgttgatctattgtttgtactttg catggctgagcctaaagagtg 439 BY880128
CMFL007_D03_F gSNP01184 agccctttccacaatcacag cctggggcatcatttacttc 430 BY880136
CMFL007_G01_F gSNP01189 ggggcaaatttgaaggaaat ctgaaccaaaggaggagcag 426 BY880206
CMFL007_H24_F gSNP01191 gctttggggtatgttgccta ggccagtttggtccaatatc 460 BY880251
CMFL007_J13_F gSNP01194 attgtggacggaagaccttg tgtgtacgtgctccttctcg 435 BY880288
CMFL007_J21_F gSNP01196 aagatcttgcgagagcaacc acttcttctctgaccgtgcc 437 BY880296
CMFL007_J24_F gSNP01198 gcgaagaatcttgtgagctg gcaaattctcggttttacgc 447 BY880299
CMFL007_K08_F gSNP01202 tcatgaacatatcggccaaa ggtgcgcataagtgaatcct 415 BY880306
CMFL007_K18_F gSNP01204 catggccactcggtactttt gtcggttcgactgatcctgt 512 BY880316
CMFL007_K22_F gSNP01205 attgtggatgttccaaaggg acattggcaaagaaagcagc 451 BY880320
CMFL007_K24_F gSNP01206 attcgatctgccaaacaagc tgggcataaggctattcctg 416 BY880322
CMFL007_N07_F gSNP01217 aaacgaagatctgttttgcga atttcatctctacccaaaatccc 366 BY880377
CMFL007_O21_F gSNP01221 ccatattgtggcaaacagga cagccattgtacgggtctct 410 BY880415
CMFL007_P03_F gSNP01222 tgcttcttctgtgtttccgtt aaacgtgtcgttggtgtcaa 441 BY880421
CMFL007_P07_F gSNP01224 agcgatcaaaacggagaaga ctcgcttcctcgctttctta 442 BY880425
CMFL007_P22_F gSNP01230 tgtccaattacatgcctcaca tcaaatatctgaaacacccga 428 BY880440
CMFL008_A13_F gSNP01232 tctgcgagtttcacagttgg gcatgcaggcatgaagttag 430 BY880455
CMFL008_A19_F gSNP01233 cccttcatgatgcctctttc gcttcggacacccactctaa 421 BY880460
CMFL008_B02_F gSNP01234 cctagaggcgccataacaaa aaaatggcagtgctgagacc 461 BY880467
CMFL008_C02_F gSNP01236 aacaaaaggtgtgccgtgtc ccttctgcaaccagctcttc 428 BY880488
CMFL008_C19_F gSNP01237 tcgtgttgtagttggtcgga caggggaaattttgcagtgt 410 BY880504
CMFL008_C21_F gSNP01238 ccaggaacttctgagcaacc ggcttcttgttgcagaggtc 516 BY880506
CMFL008_F12_F gSNP01243 ggcaaaagtggcatatgtgtt acacttgggagtcgttttgg 491 BY880565
CMFL008_H10_F gSNP01248 tcccgtgggaatgaataaaa cagggttagagccgattcag 504 BY880611
CMFL008_H12_F gSNP01249 cctggaattgaggagagcag tgaaaaacaaagtgccctca 469 BY880613
CMFL008_H13_F gSNP01250 aaaattcggagggatccagt tgagccatgcaattaactcg 488 BY880614
CMFL008_K05_F gSNP01257 caaaccctttccattccaca ccgacaaaggttttggaaact 448 BY880673
CMFL008_L03_F gSNP01258 tctgtgctgtcgtgaaaacc gaccaatccacctgcaaagt 407 BY880692
CMFL008_M03_F gSNP01262 ttcgtgataaaggacattggc gaaaccttttgaaatacagcga 424 BY880713
CMFL008_N05_F gSNP01266 gaattctgggatgtgcaggt tggtgtcaaagtgatggaaaa 472 BY880738
CMFL008_N20_F gSNP01269 atcggtagtgggaaatgtgc tagtctcccctgatgcaacc 434 BY880753
CMFL008_N21_F gSNP01270 gagtggttgagggtttggaa caccaccaattgtagtggca 447 BY880754
CMFL008_N22_F gSNP01271 tgaggagcacagttttgtgg accagaaccaacctgaagca 435 BY880755
CMFL008_N23_F gSNP01272 agttgcagaggccttcaaaa aacctcccgcttttgagatt 492 BY880756
CMFL008_P13_F gSNP01277 ttgatgaagaaagggaagcg gaaggggagttgagcttgtg 454 BY880794
CMFL008_P20_F gSNP01278 tccacgtggcacataacatt tctgtataaatttggcccgc 452 BY880800
CMFL009_A09_F gSNP01279 gctgagttgagatccttcgg ttggagatccttctgtaaatgac 372 BY880811
CMFL009_C07_F gSNP01285 ttgttctctccgacacatcg ggttggataattgaaggcca 411 BY880853
CMFL009_C20_F gSNP01288 aagttgacagcattcggagc tgagcagtttaagcgaagca 327 BY880866
CMFL009_E17_F gSNP01292 acaccaggatcaaagccaac agggtggcccttactttagc 401 BY880909
CMFL009_F03_F gSNP01294 cctgttggacacaacctcct ggacccctcactctagggaa 463 BY880918
CMFL009_H08_F gSNP01299 caaaagaatggtgcccaagt aaaggagaaaacccaatggc 356 BY880968
CMFL009_H24_F gSNP01300 ctcgcaagcaaacatcagag ggagacgatagctgctcctg 357 BY880984
CMFL009_J15_F gSNP01303 aatacggagaattccgagca tttctgtacccctcttcccc 429 BY881019
CMFL009_K09_F gSNP01306 tgttgcaatctttgaaggaaaa tgaaataaagctacaacacaatgc 357 BY881037
CMFL009_K17_F gSNP01307 tgagaaatcaaatccgaggg ttcactctcttggaccgctt 393 BY881045
CMFL009_K21_F gSNP01310 ccggttcatggtggatacat tgaaacacccaatgcagaaa 447 BY881049
CMFL009_L13_F gSNP01311 gccctagaaaaatggaggga tggcaaagtctcaatccaca 447 BY881063
CMFL009_M11_F gSNP01314 tcgaatttatgtgggaggga ttagttggcagcgatcagaa 407 BY881085
CMFL009_N07_F gSNP01315 acagagaagccttgcatcgt caggcatacccacctgaact 436 BY881103
CMFL009_N21_F gSNP01316 tcgcttgttattcgtcctga ccctagtgttctgtaacggca 438 BY881117
CMFL009_N22_F gSNP01317 caagagctgcacagcaacat ccaatgagaacaaatgatgtcc 421 BY881118
CMFL009_O02_F gSNP01319 cgccctatttcccaaataca actgccgtggaaacgtagat 385 BY881122
CMFL009_P14_F gSNP01322 gacttggcagtggtagcctc gccactggaagttcctgaaa 380 BY881157
CMFL009_P15_F gSNP01323 agcgcacttctctgtgattg aatctggcggtaacgaagtg 431 BY881158
CMFL009_P16_F gSNP01324 gccattcttaaggaagctgg tcccatggctgtacgttgta 414 BY881159
CMFL010_C05_F gSNP01330 tggcgtgagattgctaactg gcttcactctgaatccctgc 310 BY881217
CMFL010_C06_F gSNP01331 cagctgtatgcaggagaaaca caaccatagcctgcaccttt 432 BY881218
CMFL010_E02_F gSNP01335 aatggctttctctgctgcat ttattgcccctgaaacgaaa 342 BY881260
CMFL010_F16_F gSNP01340 caaacggcattgcaattaga tgcgacaaatcttgaggatg 323 BY881296
CMFL010_G05_F gSNP01342 atggcgtctagttccaccac tactttccctcgttgccttg 440 BY881308
CMFL010_H01_F gSNP01345 tttggaacattgcaagtgga ttaccttttgcacaggaccc 513 BY881327
CMFL010_H04_F gSNP01346 ggggcagtgaataacacgag ttcacccagctacaagggac 361 BY881330
CMFL010_I13_F gSNP01348 cctcggatttgaacacagga ttggaatatgaaggccgtgt 307 BY881363
CMFL010_K22_F gSNP01353 gcattgacgaaagctacaagg tttgaggccagattctcagc 373 BY881416
CMFL010_M21_F gSNP01355 cgaattgctctgcaacaaag ttattaacgccaccctgacc 305 BY881459
CMFL010_O08_F gSNP01356 tcctctaagagcaagggcaa ttttgaaacccagaccttcg 302 BY881494
CMFL010_O14_F gSNP01357 tctccatacagcagcagcaa aataggaatcaagggggctg 373 BY881500
CMFL010_P05_F gSNP01359 tcatgaaagcaacgcacttt tgtatgcagatatgtctaagagtgga 314 BY881513
CMFL010_P08_F gSNP01360 aacaatggcagttctgggag atgacagctgtttgggttcc 336 BY881516
CMFL011_A11_F gSNP01361 gggcaagtaatcaggtccaa agaagcgattccattcctga 313 BY881542
CMFL011_A20_F gSNP01363 tccggatgggactatctttg ctctctctttccatgcgagc 404 BY881551
CMFL011_B04_F gSNP01365 cagggaaaatgtctgatggaa agtttagtttgattgggaacgg 390 BY881559
CMFL011_B10_F gSNP01366 aacgctcgttttcttcctca aatttccaaatgttcgtggc 476 BY881563
CMFL011_B15_F gSNP01368 ttccacacattttggagcaa gttcatttgcagattgcagc 402 BY881568
CMFL011_C09_F gSNP01372 ctcaggctatggtgtgagca ttgaaaaactcgagaaccca 441 BY881586
CMFL011_C12_F gSNP01373 gctcttcacacccatctcaa catgaatcctgacctgctcc 306 BY881589
CMFL011_D08_F gSNP01374 aatgttaaccagaatgccgc tttttctcgtttggccagtt 422 BY881606
CMFL011_D12_F gSNP01375 agtggagaagaacctccggt tggggcaagtaggacttgaa 303 BY881610
CMFL011_E01_F gSNP01376 cgccaagggttttctttgta attcgctgagcgctctctat 326 BY881617
CMFL011_F09_F gSNP01380 taggtatggttttgccccaa gcggaagagtgtcaacacaa 428 BY881648
CMFL011_F20_F gSNP01382 ggaggaaaggagtggatggt acatccacgacatgggagat 369 BY881659
CMFL011_G12_F gSNP01383 atacatccggcaggaacaac ttgaggaccatgtccttgtg 458 BY881675
CMFL011_G16_F gSNP01384 catgctgtggaggaaagtga aagcagaatggtatgctcgg 406 BY881679
CMFL011_G22_F gSNP01385 gctgtcagtccacgagcttt catgccatggtttcaaacag 437 BY881685
CMFL011_H01_F gSNP01386 ggttgcgaagtgcttctctc agtcccttcatgaacctccc 430 BY881688
CMFL011_H20_F gSNP01391 tgccatccttctttcagtcc atgcacctgcacaatcaaga 399 BY881707
CMFL011_H22_F gSNP01392 acgacagtttctggactggg ctccagtcttccagcagctt 336 BY881709
CMFL011_I05_F gSNP01394 ggccttctgccttttctctt gtggggcgtcattataaacg 362 BY881716
CMFL011_K01_F gSNP01402 gaaatggaatccgcaatgat cggaaagctgcaggtaaatg 358 BY881759
CMFL011_L14_F gSNP01406 tccaaatccaccacaattca aaccatgggggattctaaca 363 BY881791
CMFL011_M18_F gSNP01410 aaaattgggatttttgggct gcgctgacagtgacaatgat 418 BY881814
CMFL011_O01_F gSNP01412 ctggtctcaatgtcgctctct tgtccttgcatccatgtgtt 318 BY881844
CMFL011_O06_F gSNP01413 tgggttttagcaggctgttt ccaatcacatcatccactgc 310 BY881849
CMFL011_O20_F gSNP01415 gatgtggtggaaattgctga catctgcatcctggtgaatg 379 BY881863
CMFL011_O24_F gSNP01416 tacagaggaagaagcacaccc catgggcaagcagtaaatca 324 BY881867
CMFL011_P07_F gSNP01419 gtgtcctaccaatgccgaat tgaagtaccagcgcattttg 417 BY881874
CMFL012_B04_F gSNP01421 tccattagaggaagccatgc cggcttccaaaatgaaaaga 422 BY881918
CMFL012_C01_F gSNP01423 tgctgtagcagcaaaatctaca tctgtttgctgtgtcatccg 409 BY881939
CMFL012_D09_F gSNP01429 tgggaaatctacccacgaag tcctgatgatggattgctga 313 BY881968
CMFL012_D20_F gSNP01431 ttccctttgccctatgtgag gaaaagggcgaatagtgctg 330 BY881979
CMFL012_F23_F gSNP01433 tgcagatgctggaatagctg ttattgggaacaccagcaca 335 BY882027
CMFL012_G16_F gSNP01434 ccctccttcagctttccag cccccattagcatctcaatc 350 BY882043
CMFL012_G21_F gSNP01435 ggagaaatggtggcaaagaa gatgttaaagagcaggggca 434 BY882044
CMFL012_H03_F gSNP01437 attgtcctgcggatatggag acattcctccacaaaggacg 386 BY882048
CMFL012_I01_F gSNP01438 atgcacctgttcaatgcaaa acatctgttgcaggagaccc 374 BY882064
CMFL012_I07_F gSNP01441 cgttcaactttttgaagagca catttccttagatagatgaattgaaca 372 BY882070
CMFL012_I23_F gSNP01443 gggaacgacgaaaattcaaa cgagttgagactaccaatgcg 309 BY882086
CMFL012_J01_F gSNP01444 ccgaagaagaggacatggag agcagtaagcaaagaggcga 386 BY882088
CMFL012_L14_F gSNP01447 ttgctttcataatttggccc gcctcgtcctaacgtactgc 352 BY882149
CMFL012_P01_F gSNP01449 agtatggtcagcgcgtttct gcatccacctttttaatggc 323 BY882224
CMFL013_A06_F gSNP01451 tcatgcgcagtcacattttt cggattccacaaccttctgt 433 BY882247
CMFL013_A13_F gSNP01452 tgctttccacctgatgtttg taacaattgcttgccctcct 372 BY882254
CMFL013_A21_F gSNP01453 gtgtgagaatccttccagcc ttctcgatgaattccaaggc 417 BY882262
CMFL013_B17_F gSNP01455 aaaggcagaggcagagacaa tggtccagttcgctcatgta 414 BY882282
CMFL013_C24_F gSNP01459 ggagatcgtagggcagatga aggcacagagaggaccaaaa 368 BY882313
CMFL013_D10_F gSNP01462 ttttgctttgcttttgattgaa tcaaacacagtcagaagacctctc 377 BY882323
CMFL013_K19_F gSNP01474 ttgggttctctgcctcaact ttcgaggcaatttaaacgct 375 BY882494
CMFL013_K24_F gSNP01475 atctgtgtgcagtgcagagg taggttttctggcttgcgtc 434 BY882499
CMFL013_M20_F gSNP01482 gaagcaacaacaaacaaacatga aatggagcctctcttcctcc 348 BY882542
CMFL013_N24_F gSNP01485 cggaggcatttcagttcaat gcagaggaggctaggttgtg 374 BY882569
CMFL013_P09_F gSNP01491 gtctggcttcagcaacgag aatgtgcaatttcaggtgcc 373 BY882602
CMFL014_A12_F gSNP01492 cattggtactgggaagaccg gctctgacgagtcccacttc 327 BY882628
CMFL014_A23_F gSNP01496 ctgatgccaaaactcgaacc actaaaagcgatgccgtagc 377 BY882639
CMFL014_B18_F gSNP01498 tcatggaaatcagaatggca catgtggtgtggagaccttg 495 BY882657
CMFL014_B22_F gSNP01499 tccccaatacaaacatcgtg tggaagtgttcacagccttg 395 BY882661
CMFL014_C07_F gSNP01501 tggaacccagcctaaatgtc cagccgtcttctgttcttcc 343 BY882670
CMFL014_C22_F gSNP01503 caatcatttgattcactgcca ggttgaaccttggatctgtga 440 BY882685
CMFL014_E11_F gSNP01506 agacgtttcctttgggcttt gcctgtcaacccaggaaata 495 BY882718
CMFL014_F03_F gSNP01508 gctgatgcgaactctctgtg tctcaaccttgcttcaccat 310 BY882732
CMFL014_F05_F gSNP01509 ggggtgtattagtaagatcgtgtg aacaacatctgcgtcttgga 363 BY882734
CMFL014_F12_F gSNP01510 cttcttgtcctcccatccaa cagtcaatggatgatcagacg 511 BY882741
CMFL014_G03_F gSNP01511 tgcagattgaaattgatggg tcacttttgattgcctcgtg 309 BY882756
CMFL014_I05_F gSNP01514 tgaaaatgcagattccagtcc cccaacgccttaccaaataa 301 BY882805
CMFL014_J03_F gSNP01515 tgcgctcctgtaagaacttg gccaagaaaaatcttgtccg 307 BY882826
CMFL014_J19_F gSNP01517 ctccacatcaacttgcagga catgtctgtgcctcaatgct 429 BY882841
CMFL014_K19_F gSNP01521 tactctaaaaaccgcgtggc gctttctggttctgagcagc 405 BY882864
CMFL014_M19_F gSNP01525 ttacggctcagatcaaggct tcattcgttttggtttcggt 315 BY882911
CMFL014_M24_F gSNP01526 atcctgctgaaatgaatgcc cagaggcccaaaaggtgtag 317 BY882915
CMFL014_N19_F gSNP01527 tcaatctgcagctctcgtgt gctgtttcctctgcataccg 466 BY882933
CMFL015_A03_F gSNP01529 ctgacaaaggacccacaagg aagtgagaaccattgcctgc 424 BY882988
CMFL015_A06_F gSNP01530 gaagagccttgaaaggcaga gctatctggactttggcagc 331 BY882991
CMFL015_E15_F gSNP01537 caaaatccacagcagcaaga ggcttccagagaattggga 446 BY883093
CMFL015_F11_F gSNP01540 aaaagagcctgcacttcctg tcgaactcccagcaaaaact 345 BY883113
CMFL015_J02_F gSNP01545 accagcactcgatctcttcc cgtacttccgcaactcttcc 411 BY883200
CMFL015_J12_F gSNP01546 tttcaatacaaacacgggca gaatcgtaggcctgttgcac 336 BY883210
CMFL015_K17_F gSNP01548 ttcgggaaacaaaattggag ccatgatctcgaacctgctt 313 BY883237
CMFL015_L01_F gSNP01550 tgaattgcagcaaacatcaa accacaaggacccatattgc 350 BY883245
CMFL016_A12_F gSNP01562 caacaatggaagctcacacg gaagcgtggaaccattttga 381 BY883370
CMFL016_B09_F gSNP01564 tcagctagattccgggctta cataacttgatggacgggct 401 BY883391
CMFL016_B18_F gSNP01566 tactgacggcactcgtgaag tccgatgcctggtttagttc 323 BY883400
CMFL016_E22_F gSNP01574 gtcactccatccctctgctc ctttagggcgctctctctcc 365 BY883472
CMFL016_H12_F gSNP01577 cctacgtcgggagtacgaaa tccatctcagcgtagctcct 401 BY883530
CMFL016_H16_F gSNP01578 ggaagctttgcaaaagatgg tagaaacctgcattccctgg 440 BY883534
CMFL016_H18_F gSNP01579 gccaaaataggtggctttca gtatggtgtaccaaaggccg 363 BY883536
CMFL016_J02_F gSNP01582 cggtttgcattcttgtcttc caggagtgcagagtgaatcg 425 BY883562
CMFL016_K12_F gSNP01584 ccatccctgcaaacaaagtt ctgcctctatcctacgcctg 386 BY883591
CMFL016_L15_F gSNP01585 ttctgggagtcttgaaaccct ccaggtatacgtcctgcgat 342 BY883613
CMFL016_L22_F gSNP01586 tagagccgatcttccgtctc gccgctttgtgtaaaatggt 385 BY883620
CMFL016_O15_F gSNP01589 atccaccccttcagttgaca gcacacaccatatacggcac 399 BY883682
CMFL017_C02_F gSNP01598 gtgctaggaaatctggctgg aacgttattcgaagcatggg 398 BY883760
CMFL017_C03_F gSNP01599 cagatggcttgtgttggttg gccccacagagacctgtaaa 435 BY883761
CMFL017_G21_F gSNP01610 agctgggtctcagtctgcat acttcccacacggctatcac 315 BY883872
CMFL017_J04_F gSNP01617 ataacagtggcccctttgc tgggcggaacagacttatct 331 BY883926
CMFL017_L21_F gSNP01628 cgtagagaaaagagcacggg tcccccgtggatgtaataga 368 BY883990
CMFL017_N09_F gSNP01631 attgcctgccagtgtaatcc acagcaaaaactggagtgcc 378 BY884024
CMFL017_O19_F gSNP01634 caagttacttcagcagctggg gttctccggaacaaagtcca 352 BY884057
CMFL018_C03_F gSNP01638 gcatcatgcgaatattgtgg tgatctgcagtaacatccgc 434 BY884133
CMFL018_D05_F gSNP01641 tggaaaaatcacccacaaag atccaagagcttcaggggat 353 BY884158
CMFL018_D13_F gSNP01643 tcaaggtgtttcaggcttca gccttgtttgaagtacggct 407 BY884166
CMFL018_D23_F gSNP01644 caccatcacagcttggacag acagctcgatgctctgcttt 388 BY884176
CMFL018_F05_F gSNP01647 ctctgcattacctgcccatc tcattcaaaacaaatgccca 385 BY884206
CMFL018_G08_F gSNP01648 ggttctggggtagtccagtg ggcacaaccaccaactttct 431 BY884233
CMFL018_H19_F gSNP01652 ggaggaattcatggcagaaa tgaacacatctgtggaagga 437 BY884268
CMFL018_I15_F gSNP01655 aaatggatggtgtcagaggc acgataattgtgagcggagg 331 BY884287
CMFL018_L09_F gSNP01667 aagattctcgcacaagaggc ctctcattttccttcccgtg 356 BY884350
CMFL018_M10_F gSNP01672 tatgcaagatcccaagaccc gcatatgccgaatacccaac 415 BY884375
CMFL018_M16_F gSNP01673 gctcattccaggtgagcaat tttgtccagtcaagcctgtg 440 BY884381
CMFL018_M21_F gSNP01674 ttcagttgcaaatccctcct taaaaatggcctttcccaca 360 BY884386
CMFL019_A05_F gSNP01680 tgatcccctgtcgaagaagt ggcttgttgcgacataacct 348 BY884464
CMFL019_A18_F gSNP01682 tcgactttgtattcgcgttg gcaaattaatgcagtgtggc 388 BY884477
CMFL019_D22_F gSNP01688 acagagcaggaggatcgaga atatgcaattgctgctgctg 417 BY884550
CMFL019_D24_F gSNP01690 actaccggagaatcgtggtg ggtgaaaaatccaaccaagc 388 BY884552
CMFL019_F18_F gSNP01692 aattatttggatggtgcgct ttgttaatgacagcctgggg 304 BY884593
CMFL019_G19_F gSNP01696 gcttcaggctgcttatgagg tctccaaatgggcaattttc 398 BY884618
CMFL019_H04_F gSNP01698 tgaacccccagatttttacg ccgccttgagctctgattac 330 BY884627
CMFL019_J19_F gSNP01704 aaactgccttgcaactttgg gcaatgtcgcatacacaacc 302 BY884688
CMFL019_K05_F gSNP01705 tggagatgtgagcgaaagaa gcttcttcttcgtagggcaa 406 BY884698
CMFL019_K17_F gSNP01708 tggatccaagctatggaagg gaaccaccatctaagcccaa 381 BY884710
CMFL019_K23_F gSNP01711 atgacatggccccaaaataa gacgatggtgttgacgattg 418 BY884716
CMFL019_L16_F gSNP01713 cgacacctgcttttggaagt tggagtagtccggccaatag 347 BY884733
CMFL019_P02_F gSNP01720 aaaaatgtgcaacttggtgg tgcaacaagttttcagcaca 320 BY884814
CMFL019_P03_F gSNP01721 agggaaaggaactccatgct tgcatcttctccaatcctga 359 BY884815
CMFL020_A05_F gSNP01724 cgttcgtagaaaacgtgcag tggagatgatttgtttcgca 455 BY884840
CMFL020_A17_F gSNP01727 gtggttgtcggaggtagcat tgttggtgaggcacaaaatg 509 BY884851
CMFL020_B20_F gSNP01730 gcttatcccgtccagaatga gcaaccacaaatgctcttga 391 BY884877
CMFL020_B23_F gSNP01731 aattcgtgattgtcccaagc tctctatgcccacatcctcc 515 BY884880
CMFL020_C13_F gSNP01734 tttttcgacgtttcagatcaa cttcccaaccaccttaagca 308 BY884894
CMFL020_C17_F gSNP01735 gcgagggaaaggataaaagg ttgaaaggtcagggacaacc 483 BY884898
CMFL020_D12_F gSNP01737 tttgcctctgctccctttta gtccaggcaacatacatccc 446 BY884916
CMFL020_E15_F gSNP01741 tatttgttagcggtgtgcga attcatttcgggaaggcag 407 BY884942
CMFL020_G04_F gSNP01745 gactagccgtcaccacatca agcaaatcctaaaccctgcc 307 BY884978
CMFL020_G18_F gSNP01746 agcaatggaatggagctcag tgttctcttctggtttcccg 449 BY884992
CMFL020_I02_F gSNP01749 ttcggaaataaactgggacg tccaatgacacgctcttcag 397 BY885024
CMFL020_I22_F gSNP01751 tcacagatctccgtcagcac ccagcccttcaagacttctg 446 BY885044
CMFL020_L03_F gSNP01761 gatctgccaaacaaagcgat cgaatggataccccacagtc 424 BY885096
CMFL020_N11_F gSNP01764 gcgctaggttgtgttggttt gccttgcttacaaaggcaat 389 BY885152
CMFL020_O21_F gSNP01771 tccgttctgctctgacaatg tgcctgtatgagtgtctggc 446 BY885186
CMFL021_A02_F gSNP01773 agccaaggttttggtgagat atatccaacaggagatccgc 412 BY885214
CMFL021_B15_F gSNP01777 agcggtacaaacgtaaagcc aagttctccaatggcctcct 439 BY885249
CMFL021_C08_F gSNP01778 aactcgtgcaagtgctttatga tatgcttgccttgcatgttc 312 BY885266
CMFL021_C10_F gSNP01779 cgaattcttctcggttttgc gcagcttctccattattcgc 428 BY885268
CMFL021_C11_F gSNP01780 agggtgaggctgggagtaat cattggctccatgcattcta 413 BY885269
CMFL021_D15_F gSNP01783 caaagcaatcgatgcaaaaa ggctgaggcatacggagtag 374 BY885296
CMFL021_F17_F gSNP01785 ttcgtagagggaaaccatgc caatattcctggcccaactg 361 BY885346
CMFL021_G10_F gSNP01787 taatggagctgtcaagccct accaagaggccttgtgaatg 360 BY885363
CMFL021_I06_F gSNP01798 aatcggggcatatggtgtaa gcggtgataattgccttgat 318 BY885406
CMFL021_I20_F gSNP01799 ttgggagaagatgcaaaacc gacttgaaacccttgccaaa 425 BY885420
CMFL021_L18_F gSNP01805 catggtggattctgccttct tgtcattggcaagcacca 347 BY885489
CMFL021_L19_F gSNP01806 catcggatcctcttcttacagg agtcaaatgaaagagccccc 318 BY885490
CMFL021_M19_F gSNP01809 cttcctattctgatgcccca cattgaagcttgcagttgatg 403 BY885513
CMFL021_O14_F gSNP01812 aagctttcttcccccaaaaa atggggctgacattgctaga 371 BY885556
CMFL021_O22_F gSNP01813 ttatccccataggacaccca gcattttctttgcctccttc 434 BY885563
CMFL021_P18_F gSNP01815 tggattttcagattggacgg ttaatgctctctgattgccg 419 BY885583
CMFL021_P24_F gSNP01816 gagtttgttgatggcacgtc agcgttagggtgcagaagaa 448 BY885589
CMFL022_A08_F gSNP01817 tggtttggccctggtagtag tatcatttccccaacaaggc 408 BY885595
CMFL022_A14_F gSNP01818 aaagtcacaaacagcagggaa ctggagcagtttttgggatt 336 BY885601
CMFL022_C01_F gSNP01822 gggtttaatgtgcgtctgct agaacagtttatgcgcggac 410 BY885629
CMFL022_E05_F gSNP01827 ttcaccagctcaacttgcttt ctgccatatggaatctcttca 372 BY885672
CMFL022_E18_F gSNP01830 atggtgagcagaaggagcag atgtggagcaccaacaacaa 395 BY885684
CMFL022_G11_F gSNP01833 ggtgccactgaattcaacagt aggccagacatttttcagga 398 BY885725
CMFL022_H03_F gSNP01835 gggaaggggaaaagacattc cgtcattctccgtacagcaa 424 BY885739
CMFL022_H13_F gSNP01838 caagttaaaccatggcagca gttaaggatgcagagggctg 385 BY885749
CMFL022_H18_F gSNP01839 ggtttgctgggtttcttcaa atgccggtgcagatcaaata 358 BY885753
CMFL022_I11_F gSNP01842 aaatactgcggccctttctt tgaaggaattagccttcgga 345 BY885768
CMFL022_K24_F gSNP01848 tgcttccatttgtcttaacttca gcataatggtgatgccacag 410 BY885817
CMFL022_L19_F gSNP01850 ggcaaaaagcgcaataaaaa gggatttgatccagctctca 377 BY885834
CMFL022_L23_F gSNP01851 acgtgcaatttttccttgct cccgcaatattccttgtttc 421 BY885838
CMFL022_M18_F gSNP01852 cccttcattctgttgttcgc cagaatggcagccagactta 333 BY885857
CMFL022_N18_F gSNP01853 ctgctgcattccctcattct catggcctttaccatcgact 347 BY885881
CMFL022_P01_F gSNP01859 ttcttcatctccgtgtgctg aactctaaccctgccccaat 402 BY885912
CMFL023_A01_F gSNP01861 ccccagagaatggctgatta ttaccccagtgcagagatcc 401 BY885936
CMFL023_B11_F gSNP01865 gcagaggctggagtgagatt cctctcgtcaactttttccg 402 BY885968
CMFL023_D05_F gSNP01869 gttggatggggtctagggtt gtgctgccttgttttgtgaa 452 BY886005
CMFL023_D13_F gSNP01871 cgctaatggtcttgtgggat ttcccacctatagatctgcca 354 BY886011
CMFL023_E11_F gSNP01874 agaggggcttgaccatttct tccagtgcgtcgtaatttga 451 BY886030
CMFL023_E14_F gSNP01876 cctttcctgcgctttatcag ttcagggctcagaagttgct 429 BY886033
CMFL023_E17_F gSNP01877 cgtcttgtgacgaaatcacg attagtccggcctctccaag 362 BY886036
CMFL023_E21_F gSNP01879 aatgggaagctttctgggtt tctgtgagcttgctcttcca 429 BY886040
CMFL023_F13_F gSNP01881 ttggaattgtgggagaggtc acgagaccaatcagaaacgg 457 BY886056
CMFL023_G21_F gSNP01885 taaataatgtgggcgccttt taactccgttgggattgagc 459 BY886086
CMFL023_H04_F gSNP01886 ttgatcatccaggagcaatg gctataagccagcccatcaa 458 BY886093
CMFL023_H11_F gSNP01887 gcgaaatctcttgtggtggt gtcaagctgtctctcctgcc 473 BY886100
CMFL023_J21_F gSNP01896 aaagcgaagagaggagaggg ttccagaaagcgttggaagt 365 BY886157
CMFL023_K01_F gSNP01897 acagcatgctttcgctgtaa tccaaaaacagcacacatcaa 385 BY886161
CMFL023_K23_F gSNP01898 cagatgggctactctgtgctt ccctaccattacatggcacc 512 BY886182
CMFL023_L01_F gSNP01899 attgggggtttgggaaaata gcagactcagtgctagccaa 371 BY886184
CMFL023_M20_F gSNP01903 aaatattcggaggcggaaag ttggttctacttgttccggg 324 BY886223
CMFL023_N12_F gSNP01906 tcgcgcactcagtaaaaatg ctctccggaccacacaaaat 334 BY886239
CMFL023_P01_F gSNP01909 tggctaagaaccagtttggg atgcacacagcagttgaagc 441 BY886274
CMFL023_P21_F gSNP01911 gccaatctcccaacaaagtc actgttccatgctttgccat 441 BY886294
CMFL024_A04_F gSNP01912 gaaaatgccttcgaatctgc ctccatcaccacgcttcttt 357 BY886300
CMFL024_A10_F gSNP01914 tcacttgaggaggagattatcca gcaaagagcttcaaggcatc 390 BY886304
CMFL024_B10_F gSNP01916 taccagcttggatcttgcct tcgaagagaaccgctgaaat 431 BY886324
CMFL024_C22_F gSNP01920 tgaatagatcacgcgagcag ccaagcgttttcttgtagcc 359 BY886357
CMFL024_C23_F gSNP01921 gctggctatggggttaggat gccagaggtagaagaacccc 408 BY886358
CMFL024_E18_F gSNP01926 aaggatgaagaaaggcccat gaagctacaggctgagtggg 408 BY886396
CMFL024_F09_F gSNP01927 tgtgtgcatcagcaaagtca gagacacattgcccattcct 475 BY886411
CMFL024_F23_F gSNP01929 atccgagtgcaagtctgagc tatgagcagtccacattggc 355 BY886425
CMFL024_G04_F gSNP01930 aggaaatagggacgaaaggc aaggctggttgacaaatgga 388 BY886429
CMFL024_H04_F gSNP01933 gattctccaggttgtttcgg gcaccgtaggggaactgata 458 BY886450
CMFL024_I14_F gSNP01936 gcgcagggtcacataaaact cgacgaattgggaataggaa 463 BY886481
CMFL024_I24_F gSNP01937 cagttgaagatggcatcgag gctttgatattccctttggc 426 BY886491
CMFL024_J16_F gSNP01939 gcaattgcagagtacggtca cgtcggtggaccactaaact 315 BY886504
CMFL024_J23_F gSNP01940 tgctttacaagcacgaaacaa aagccgtctgtttatgtggg 331 BY886511
CMFL024_O10_F gSNP01950 cgttttgaagcagaacggat agctccaagccgtaaacaaa 381 BY886610
CMFL024_P09_F gSNP01953 gaccatggcacttttccagt agcgcagtttctcgtcatct 410 BY886632
CMFL024_P13_F gSNP01954 aagaagcggctcattgctaa atagccactgccaaacatcc 321 BY886636
CMFL025_B06_F gSNP01959 agaggccctattgcgagaat tgcttcttgtgggtagtcca 362 BY886675
CMFL025_B09_F gSNP01960 ccgacttttgtatcctcaacag gtcgggaaacaaacctcaaa 423 BY886678
CMFL025_B20_F gSNP01962 agtagctgttgttggtgggg tcttttctgcccgcactatt 461 BY886689
CMFL025_C22_F gSNP01963 ctaatgcttcccgtcatcgt tcattcttcgactggaaccc 416 BY886713
CMFL025_F16_F gSNP01971 cctctgatctgaaaggcagg tgcaatagttggaattctctgg 369 BY886777
CMFL025_F22_F gSNP01972 gcaattttgtttacctcgca tccaaaaccctaacgtcctg 332 BY886783
CMFL025_G02_F gSNP01973 tgtggcaatcttcccttctc gttctcgccactcctagcat 340 BY886787
CMFL025_I17_F gSNP01981 ttgagttgaggataacccgc tgtaaaccctaatggctggg 382 BY886849
CMFL025_K06_F gSNP01986 cttgtgattgcatttgtggg cagaaggcaggcttcaattc 453 BY886882
CMFL025_K08_F gSNP01987 gtacagccagagtgttggca attgccacccacctaaacaa 390 BY886884
CMFL025_L15_F gSNP01991 gggtgcccttgtgagtttta atgcccaattcattgctttt 374 BY886913
CMFL025_M17_F gSNP01992 gtctttgtttgcggggaata tggcttgtgaaaacttgtgag 415 BY886936
CMFL025_N04_F gSNP01993 ttgtgtatacccagcacgga ccttctgtggcgagttgaat 403 BY886947
CMFL025_N08_F gSNP01994 tccgatgtattcacctccact gttcatccttcgccattgtt 369 BY886951
CMFL025_N16_F gSNP01996 acaaagcaagcgtagcagtg cttcaattgctctttaacaatcca 385 BY886957
CMFL025_N18_F gSNP01998 aacatctagggcagcattcg tatggaaacgcctttgtgct 324 BY886959
CMFL025_O12_F gSNP02000 tatggaggggaaagtggatg atttgccacccatgtagagc 505 BY886977
CMFL025_O19_F gSNP02001 tgaatgggatggtatcagca tcttgagagttcggcaggat 581 BY886984
CMFL025_O24_F gSNP02002 tagctctatttgccctgcgt tcgatctcttcccttgcttc 407 BY886989
CMFL025_P04_F gSNP02003 gaagggatggatctgcatgt agaatggtgttgtggggtgt 398 BY886993
CMFL026_A09_F gSNP02006 tgtctatatacggcaggggc cagctggtgttcctgtcctt 401 BY887019
CMFL026_A18_F gSNP02007 aacttttcattacaatcctggaca ggctggtccttagttattggc 393 BY887027
CMFL026_B08_F gSNP02008 tttgtgttccaaatgtgttgc tctgtccattgaacttgccc 388 BY887039
CMFL026_B13_F gSNP02011 tatcttgttggctttggcct atttcaataccgccaagcac 368 BY887044
CMFL026_C04_F gSNP02014 cccccttacctcagtggatt acccaacgtgtttttccaat 346 BY887058
CMFL026_C23_F gSNP02019 ttcgactacagcccatggtt agattcggtgttcttgtggg 380 BY887074
CMFL026_D10_F gSNP02020 acccataaaaagacccgtcc atgggaattcggaactgttg 302 BY887084
CMFL026_D24_F gSNP02022 tttcaagccattgacatcca cccatcatcagagccttcat 414 BY887096
CMFL026_F03_F gSNP02023 agctcggaagtcaagattgc tgacaaaccccacaaaatga 353 BY887122
CMFL026_F16_F gSNP02025 gagaactccacacatgcaaca gcaagctcttcactcagcttt 380 BY887135
CMFL026_G13_F gSNP02027 actcgcaaaattcaaatcgc gcattgttgagattgaacagc 392 BY887156
CMFL026_G14_F gSNP02028 atggaaccaaagccacattt cgagcttctaatccgaggtg 337 BY887157
CMFL026_G20_F gSNP02030 cttcgttccatgtccactgt cacggtatggatgtcactgg 473 BY887163
CMFL026_H03_F gSNP02031 ggattgacgccataaaagatt tggaaattcctatttattcccg 309 BY887168
CMFL026_I01_F gSNP02033 taacacacgggaaagaaggc ctctcacgccaccctctc 340 BY887188
CMFL026_I12_F gSNP02034 tctaccaattggggttttcg ccataacgaattcttccggc 399 BY887199
CMFL026_I13_F gSNP02035 ccctagcaaaccccaaatct atgagcccctgtgcattaac 399 BY887200
CMFL026_J03_F gSNP02036 ttcgaaactgtgacggtgag agggttgtctctccaccctt 436 BY887211
CMFL026_K22_F gSNP02039 gatctcttcccaagcaaacg gggagagggtttgaggagag 515 BY887247
CMFL026_L06_F gSNP02040 taggagccatcttcctccag tctggaactgtgtctgctgaa 425 BY887253
CMFL026_L24_F gSNP02042 ttgaggccatggacatagtg gatttttctagcgtttcgcc 416 BY887269
CMFL026_M20_F gSNP02046 agaaatgtgccaccttggtc gagaccaaaatttgcaagcc 372 BY887288
CMFL026_N02_F gSNP02048 gacaggcgtcactcattcaa atagcgagctcccgtcctat 417 BY887294
CMFL026_N10_F gSNP02050 tggttgtgatggtctatggg caagaggtttgcgggataaa 397 BY887302
CMFL026_N11_F gSNP02051 cctgagccctcttccctagt ctggggattcaattatgcgt 449 BY887303
CMFL026_O01_F gSNP02052 ggcaaatcattttctatttgcag atcctttaaacccttccggc 318 BY887316
CMFL026_O03_F gSNP02053 taaatgcccaagcccaatag cgtcaagttaatgtgcaccg 499 BY887318
CMFL026_P11_F gSNP02057 ccaacgagaaggacatggat ggcgatggaagatgtatgga 386 BY887350
CMFL027_A13_F gSNP02059 acagggtttgggctgtatga ttcaaaaccctcactacccaa 397 BY887374
CMFL027_B08_F gSNP02061 caacaaaacctcatgccctt acctctgcataattgctggc 380 BY887391
CMFL027_C21_F gSNP02067 tctctccttttgtgctgcaa cgttctcgagtctgagggtc 498 BY887426
CMFL027_D02_F gSNP02068 caggaacacagagcttcatca acccacaatagaacatgccg 437 BY887429
CMFL027_E04_F gSNP02069 ccgcctagtttcatttgctt ttgcaggtgatgtatcgagc 443 BY887455
CMFL027_E05_F gSNP02070 ttggttgtagagacgaagatgc tccacaccagcccatttta 448 BY887456
CMFL027_E10_F gSNP02072 catgcacagatgctgagtga tcgatcatcactcgtccaaa 494 BY887461
CMFL027_E21_F gSNP02073 gcatactgacggatattgcg caaccattgctccaaagtcc 450 BY887472
CMFL027_E23_F gSNP02074 caaattcggtaagtcgggaa gacgaatgcaaggttgatga 504 BY887474
CMFL027_F04_F gSNP02075 cacattccatcttccagcct gttgaagatgtgcacgctgt 330 BY887479
CMFL027_G03_F gSNP02078 ggctgcctcagatgattgat gaattcttcagcaatgggga 459 BY887499
CMFL027_G15_F gSNP02079 agtccatgctggcgtattg cttcccttaatttccctggc 362 BY887511
CMFL027_H06_F gSNP02080 agcagcaaatccaaaaccag aagggtaagggaagttgcca 389 BY887526
CMFL027_I01_F gSNP02083 gccctaaaatttgtgagcca tgaaatccccttcataggca 414 BY887544
CMFL027_J04_F gSNP02084 atgggtttgcgcataaagac cttgaagccctaccagtgga 370 BY887569
CMFL027_K10_F gSNP02086 tgtctcctcaactgggaattg ctgaggcaacccagagctac 391 BY887597
CMFL027_L05_F gSNP02088 tttttgagcccctgtttttg ccaacaagctctttgtccct 373 BY887615
CMFL027_L08_F gSNP02089 agttcaaacagggggtggat ttgggtttcaagtcctcagc 447 BY887618
CMFL027_L16_F gSNP02090 gagcagggaaagagcaacac tggagcccaaaataggtctg 459 BY887624
CMFL027_L24_F gSNP02092 aaattttgacaatgcggacc ttttgccgttcattaccctc 437 BY887631
CMFL027_N07_F gSNP02098 cgagaaaacagtagcccgag ggcccctctgcataaacata 394 BY887661
CMFL027_N23_F gSNP02100 ttctcggtgcctcagtcttt aaacatccacaaaagctccg 464 BY887677
CMFL027_P05_F gSNP02105 gtgttagcaagtggggcatt gcaatttattagctgcctcca 433 BY887706
CMFL027_P11_F gSNP02107 aagctgaatgccctgctaaa ggctcgaagttcaagtttgg 450 BY887711
CMFL028_A17_F gSNP02113 gctttgctaactttttggagga tccaaaaccctctgtgttcc 351 BY887740
CMFL028_B11_F gSNP02115 cccagacaacctatcgccta ttccacgagtttccttggac 352 BY887757
CMFL028_C15_F gSNP02116 gattgccttctcattggcat agctgtaaacccagcaaacg 355 BY887785
CMFL028_D22_F gSNP02122 ctgcaaaaggagctggagac tctcgtttgcaacattctcg 462 BY887815
CMFL028_G08_F gSNP02128 cccattcacgtttgtcgtact atgggagtgcataaagccaa 433 BY887868
CMFL028_G15_F gSNP02129 ccatttgtgatccctgttcc ataacccttgtccatgagcg 524 BY887875
CMFL028_G16_F gSNP02130 tggtttttgttgcagtcatttt tgcaaccaaagctgtgtagg 452 BY887876
CMFL028_I14_F gSNP02135 ggtctaagagcccccaaaac ttgaagcttctccctcaaaaa 423 BY887918
CMFL028_M20_F gSNP02142 aggcaacgtgcagattgag gcaattgaaaggtctgccat 501 BY888017
CMFL028_O16_F gSNP02148 ggattcatttgcattgggat ttcaagtcctgttgagccct 399 BY888059
CMFL028_P07_F gSNP02150 ttgcaacggattacccttgt agaccccatgttgttatcgc 471 BY888074
CMFL028_P23_F gSNP02152 gctctgcaatcagaaatggc tgtttgcagaccgtaggaca 441 BY888090
CMFL029_A02_F gSNP02153 agcttgcacaggcaaaagag cagctatagcctcagcagcc 435 BY888093
CMFL029_B07_F gSNP02157 tggtgtgttgatacttgtgcc attcttatcatttcacttgtgtgc 366 BY888122
CMFL029_B08_F gSNP02158 tccttgctcatgaagtagcg taagctctagaatgccccga 452 BY888123
CMFL029_B21_F gSNP02159 cagtggttgacgtgagtggt atatccaaggcccctatgct 418 BY888136
CMFL029_D10_F gSNP02161 gccccagtctgaagaacatc cagccctgtctgtcacttca 456 BY888168
CMFL029_D24_F gSNP02165 agcaaataagctgccaagga tctttccttcatggtctggg 441 BY888180
CMFL029_F02_F gSNP02167 gtgaaagatggcaaagctcc gcatacatcctcggcttgtt 309 BY888206
CMFL029_G04_F gSNP02170 gcaaacgaaacaatgggatt gccactgatttgtcaagggt 469 BY888232
CMFL029_G10_F gSNP02172 tgccagtagcagcaatgaag agcggaccggaaaagttatt 472 BY888238
CMFL029_I11_F gSNP02176 ggcgaatcggaacttgagta agaaaaagcacacgcaggag 419 BY888284
CMFL029_I18_F gSNP02177 cttgggcattacgtttttca ttctaccttcttgttggcgg 368 BY888291
CMFL029_J16_F gSNP02179 ggttctaaaacgttgcaggg cccaaaatctccagctctga 477 BY888313
CMFL029_K23_F gSNP02181 cttgtgccctctgctctctt ttttacaaacccccattcca 400 BY888341
CMFL029_L08_F gSNP02183 ttttctccaaattgcccttg atctgcagcttcaatccagg 472 BY888347
CMFL029_L21_F gSNP02184 gacactggaagccataggga gcagggcatataagtatgaggg 570 BY888359
CMFL029_M09_F gSNP02185 ccagggtttgtttcgttttg tcctgtctgtctgcatcacc 412 BY888371
CMFL029_M15_F gSNP02187 catatttggacgcagcaatg acaaaaacacccacaggctc 420 BY888377
CMFL029_O06_F gSNP02192 gccccttctacatagctcca agcagccaataaccgaaatg 407 BY888416
CMFL029_P10_F gSNP02193 tgattgtgaatcatggacacg aacttttggttttgtcccttca 333 BY888441
CMFL030_A01_F gSNP02198 acacgagcaaaatgcacaag tctcccctctccattagcct 424 BY888454
CMFL030_A02_F gSNP02199 tgacaagagggaaatggtcc gcttgctacgctcctgactt 387 BY888455
CMFL030_B13_F gSNP02203 attcaagaatccccaaaccc ccctctgcaatgcctctaag 468 BY888490
CMFL030_C06_F gSNP02206 gccgagacaaggagaagatg caacaccaaaattgctccct 492 BY888507
CMFL030_D16_F gSNP02209 gaagtcggccctaatgatga tggcaaatgctttctcttcc 485 BY888541
CMFL030_F15_F gSNP02217 tgccaagaaattgggttctc ggatctgttgtgcccttctc 408 BY888588
CMFL030_G14_F gSNP02220 tttggttcgtagaattcggg gcagcagaacccaccatatt 381 BY888610
CMFL030_G19_F gSNP02222 ggaggcagtgggtttcataa tactccagccatttgggaag 503 BY888615
CMFL030_H23_F gSNP02227 catgctcatgattggaggtg cagagagaggaccacaagca 471 BY888642
CMFL030_I08_F gSNP02228 tattcacgatgtttcgcagc aaaagtgagggtgcacaagc 405 BY888650
CMFL030_I20_F gSNP02229 ttttgtgcatggcttgatgt gccaaaaagttcggctatga 473 BY888662
CMFL030_J08_F gSNP02231 tcaggcaaagtcaagtccaa tcttgcaaaatcatcaacaagaa 471 BY888674
CMFL030_J15_F gSNP02233 acggaggattttgttagggg tctagggagggttcatgtgg 474 BY888681
CMFL030_J23_F gSNP02235 atgatggcgaaatcgaaaac ttacgctccatttaacggct 452 BY888689
CMFL030_O07_F gSNP02246 tccaggttttctattccccc tggcagctgatatgttgctt 457 BY888790
CMFL030_P06_F gSNP02248 ttgaccgcgatttttctttc cagaatccctttccccctac 488 BY888812
CMFL030_P15_F gSNP02250 taatcatgtgggcgttacga cgctccatcaccttcaactt 409 BY888820
CMFL031_A10_F gSNP02253 ctgccatttttacccctcaa tccttgtcctcaaatcaggg 430 BY888838
CMFL031_A19_F gSNP02256 tttttccaggtattgagccg ggagttgctgtgggttcatt 510 BY888847
CMFL031_E07_F gSNP02267 ccaacttcatccccatcttc agcttctgctggtccaatgt 488 BY888927
CMFL031_F16_F gSNP02269 gggtgaagcagaggagaaga agcaatgcaaaccacaatca 580 BY888959
CMFL031_F19_F gSNP02270 atttcattcgattcgccaag ggaaacccactaccaccctt 496 BY888962
CMFL031_G07_F gSNP02272 actgccgaggtaactgagga cgtgacacaactccactggt 419 BY888974
CMFL031_G14_F gSNP02273 ttgggaatcaaacttggagg gagggggcgatatacaacaa 401 BY888980
CMFL031_I08_F gSNP02277 tgtccaccattctctccctc ttggtgacaggaatgcaaaa 448 BY889022
CMFL031_J17_F gSNP02282 ctttgtttgcaggtttgcag tcgctttccaaagcttgtct 500 BY889055
CMFL031_J19_F gSNP02283 gctcgggaaggtatcaacaa tagtgcctagcctgtcgctt 501 BY889057
CMFL031_K16_F gSNP02286 agttacgtcacctgcagatcc cttgaaccctcgcctcatag 487 BY889078
CMFL031_M21_F gSNP02291 tcccaagccaaatctgaaac aatttggttgtaacggccag 441 BY889129
CMFL031_N13_F gSNP02292 ccgtgaggggaatactgaaa cagcaccagcaaagatggta 417 BY889145
CMFL031_O12_F gSNP02297 cctgtcctgctgacagttca gccgggagcatagttgatta 557 BY889168
CMFL031_O13_F gSNP02298 ggcaaccgacatgttttctt tggttccattcatttggaaaa 576 BY889169
CMFL031_O14_F gSNP02299 cgtgaaaaggtgttgagtgtgt accttgaaacctcagcctca 479 BY889170
CMFL031_O24_F gSNP02300 actgggtgcatatttttccg aaatcatgcgtttcccactc 439 BY889180
CMFL031_P24_F gSNP02303 ctttctgggaacacctacgg aagcagaatgcacccaagac 503 BY889203
CMFL032_B05_F gSNP02306 tgggctcagttgaatcaaga tctaaacatccttcctgcattg 408 BY889227
CMFL032_C09_F gSNP02309 aatgcacctgttcaatgcaa tgaacagaaaagaattttccaca 323 BY889249
CMFL032_G07_F gSNP02316 gatcccctggtcatctatgg cagcccatctgctgtatcaa 456 BY889339
CMFL032_G10_F gSNP02317 aggaccaaatatggcgacag cccaccgtgtttgggtatag 421 BY889342
CMFL032_I03_F gSNP02318 tgcggaaatgtgttcaccta ttcttttgcacctcagtcca 483 BY889377
CMFL032_I14_F gSNP02319 gtagcaaatgcacaggctca tcctgctgccaaagaagaat 408 BY889386
CMFL032_J12_F gSNP02324 gacagacccaattttcgcat acacagcagccttgacctct 488 BY889404
CMFL032_K02_F gSNP02327 tgagagagagccaaatacaacg aaccaaagtgctcttcacagg 413 BY889416
CMFL032_K09_F gSNP02328 agcgcatcagattcttgctt tgggtttatcttgcgtgaaa 531 BY889422
CMFL032_L12_F gSNP02329 attgcaatggacgaatcaca aaagggacttgtgcgagaga 483 BY889445
CMFL032_O06_F gSNP02334 tgtgggaattgggcttagac ctcctcggcttgttcaagag 323 BY889504
CMFL033_A03_F gSNP02338 aaaaacgtgtttggtgccat gtgaaaggcagggcacatag 442 BY889545
CMFL033_A24_F gSNP02340 gcgaagttggagaggagaaa caaccatccaagccctagaa 472 BY889566
CMFL033_D04_F gSNP02343 gcttcaattcaactctgaaatgtg ggccatccacacaatcctat 337 BY889615
CMFL033_E18_F gSNP02348 caccaggcgacttttgtgta ttcggtattgtcccttcacg 409 BY889651
CMFL033_F17_F gSNP02350 ggcaattagctcccttgaga tttccttgtgacttcctcca 511 BY889671
CMFL033_H07_F gSNP02357 tgtggatgaggagcagaaaa cactggagctcttccacctc 494 BY889707
CMFL033_H23_F gSNP02358 tcccaatttcatggaagctc ggtttttcgccacttcaaaa 406 BY889722
CMFL033_I20_F gSNP02360 ttccaatggcgaacatcata ttaaaacaatggcagggctc 495 BY889743
CMFL033_J15_F gSNP02362 aaaacatgggaggatgtcca ccttcagcctcttgcatttc 484 BY889761
CMFL033_J21_F gSNP02363 aaggcttggttgctctttga atccctggcaaagtcgtatg 437 BY889767
CMFL033_K15_F gSNP02365 tctcgtcttacaacccaggc tgcagacagagacccagttg 324 BY889784
CMFL033_K23_F gSNP02366 cgccaatggattttggtaat atccgaaacgcaaagtcatc 374 BY889792
CMFL033_L13_F gSNP02368 atgctgcatgggacatcttt aaatcccagggcattagctt 525 BY889804
CMFL033_M13_F gSNP02371 tgcagatctattgcctgtgg aaatgaagtggcaccagacc 528 BY889827
CMFL033_N03_F gSNP02372 ggtttttagcgcttttgcag tcatgatcactaccgacgga 485 BY889840
CMFL033_N06_F gSNP02373 tcgagacagatcgcatatgatt tagaattcgctgctgacgtg 430 BY889843
CMFL033_N09_F gSNP02375 tggggcttcctgtacatttt cagcaaaacagcaggatgaa 412 BY889846
CMFL033_N12_F gSNP02377 tctggtcttgcactctacgg gctattgaatgtctttccagttga 490 BY889849
CMFL033_N14_F gSNP02378 gataccgttagcccctggat cgtgcacgagctagcataga 344 BY889851
CMFL033_N21_F gSNP02380 actgccaactcctgcgacta aaatgagccacacctgaacc 386 BY889858
CMFL033_O03_F gSNP02381 gaaaagaaaaagccccgttt caaccaatcctcccttaggt 448 BY889864
CMFL033_O20_F gSNP02383 cttgctgtgctccgtacaaa cagcgctctggttcacagta 371 BY889881
CMFL033_P13_F gSNP02385 atcacacgcaatcaaaacga agtatggtggaaacggaacg 385 BY889898
CMFL034_C04_F gSNP02390 ttgaatctaaggccaccctg gtctccaccaggaacaagga 421 BY889953
CMFL034_C06_F gSNP02391 aattggttgtgaaagctggc gttcaccaggcaaatgaggt 424 BY889955
CMFL034_C18_F gSNP02394 gaggccggtccaaattagag ttctcggcctttctttgaga 406 BY889966
CMFL034_E01_F gSNP02398 attagatgccctgcagatcg ctcgaaccctaaccgatcaa 446 BY889997
CMFL034_E04_F gSNP02399 aagggtacagctttggagca gcccaacataaggaaccaga 451 BY890000
CMFL034_F03_F gSNP02404 tgtgggaagtaaatttggca gacacatttccagtgggctt 408 BY890023
CMFL034_F04_F gSNP02405 tctcgaggatgccaaaaatc aactccgcctgaaataccct 430 BY890024
CMFL034_G20_F gSNP02408 aggaagaaagccctggtcat tccacatcctcaaacccttc 500 BY890063
CMFL034_I01_F gSNP02409 ccagcttctccttctcctca tgatcttttcctgggtctgg 443 BY890090
CMFL034_I16_F gSNP02414 cactctgcctcaagttgctg gatgcatctgtggtggaatg 439 BY890103
CMFL034_K19_F gSNP02420 ttttgcatttttcctcctgg ccgcttgactaaacctgctc 513 BY890152
CMFL034_M11_F gSNP02426 gaatttgtgaaaagcagggg gagaaaaacggacaatggga 473 BY890191
CMFL034_N06_F gSNP02428 caagaaagtcagggcagagc tctgccgatagccataaacc 480 BY890210
CMFL034_N20_F gSNP02432 ttgggctactcagtggatga ggacttcaattcgaaaccca 477 BY890224
CMFL034_O01_F gSNP02433 ctgtgatgaacttgggagca aggctagcagcctgtgagag 422 BY890229
CMFL034_O18_F gSNP02439 cttggccattgatgaaaacc caattaattttagaggcttcagcag 417 BY890244
CMFL034_P20_F gSNP02442 atctgcaggacattgctgtg aggcccaaaaggaagaacat 391 BY890270
CMFL034_P23_F gSNP02443 aaatggtgctcgattagacaga atgtgacctggcatctcctc 405 BY890273
CMFL035_A01_F gSNP02444 attcagaggcatcatttggc acttcagtggtggtgaaggc 352 BY890275
CMFL035_A05_F gSNP02445 cccactcagatttccgactt cttgagagcattcacaccca 380 BY890278
CMFL035_A16_F gSNP02446 gaaatgaggggaaaggaacc tacacagcttccgcagctta 355 BY890289
CMFL035_B01_F gSNP02447 cgagatgccaagacagtcaa cacactcttccctcagcaca 498 BY890298
CMFL035_C07_F gSNP02452 cgactctcactcgatgcaaa ttctgtcgcattgatatcgc 425 BY890328
CMFL035_F08_F gSNP02458 tggatgacctctctcacacg accaagtccaattccaacca 381 BY890395
CMFL035_F20_F gSNP02461 ccgtttgccataggatgact tctactgacgaagggttggg 526 BY890407
CMFL035_G01_F gSNP02463 ccctcacgcatactccatgt gacctgcaagctctacgacc 402 BY890412
CMFL035_H12_F gSNP02468 gtcacatttggaaacatgcg ttccagccttatgtatgggg 426 BY890441
CMFL035_H21_F gSNP02470 gcagtgcttgaaaactgcaa ttcctccaccacatcacaga 478 BY890446
CMFL035_I05_F gSNP02472 tggagcttgctatctccgtt tgtatccttttgaggggtcg 499 BY890452
CMFL035_I10_F gSNP02473 ggtcgccatgaaatcaaagt caaaggctttttcagttccg 481 BY890457
CMFL035_J01_F gSNP02475 cggaggctcaaaacacaagt tacccaatacccacgtcctc 439 BY890471
CMFL035_J16_F gSNP02477 gaatccttttcaggcagcag ggtgccatcaatagaaaccaa 539 BY890486
CMFL035_K03_F gSNP02479 gttcgaaacctgctgcgtat tcctcattggcatcttcctt 455 BY890497
CMFL035_L01_F gSNP02481 tggagttagaagaggctcgg ccgatcacgttttccatcat 380 BY890519
CMFL035_N05_F gSNP02488 gttcgactttgagctcctgg aacttcagtaggttcgggca 450 BY890567
CMFL035_N09_F gSNP02489 gttgttctgcgctttcctgt attgttcccaaggctctcct 430 BY890571
CMFL035_P12_F gSNP02492 cagattccaccgctctcttc agaatctgccagtgggcat 375 BY890616
CMFL035_P20_F gSNP02494 acatatcggtgagtacgggc ctcaacaagggcagaggaag 454 BY890622
CMFL036_A16_F gSNP02495 caggtcgcaagtccctctac gcctgcaaatgttaagccat 461 BY890638
CMFL036_C16_F gSNP02504 gcgttgctattggggataga aaaatggaatcattgcaggg 468 BY890683
CMFL036_E03_F gSNP02507 ttccaaggatcgtggaagtc tatcaactggacccacagca 346 BY890716
CMFL036_E10_F gSNP02510 aaattgctcagtggtacccg ccaggtgaaaacagagggag 495 BY890722
CMFL036_E17_F gSNP02511 tgcgatgatttgctcttctg tccggaggactcagactgtt 446 BY890729
CMFL036_E24_F gSNP02512 agccttatgcaaaatctgcg aactgcattgcattggttga 452 BY890736
CMFL036_F09_F gSNP02514 aacggaagacatgtcaagca ggcatcaaaagagggttgtc 401 BY890744
CMFL036_F10_F gSNP02515 tgtctctccaattccctgct tggtgttccatgagaccaaa 441 BY890745
CMFL036_F11_F gSNP02516 tgtgatttatctgcacggga gaggcaacccaacaaaatgt 472 BY890746
CMFL036_H03_F gSNP02521 tatttcacgatgggcagagc tctgagcactggtcacaagg 434 BY890786
CMFL036_J03_F gSNP02527 aagtttgatccagaggggct tccaatgcattatcaagcca 424 BY890834
CMFL036_K05_F gSNP02531 aggtttgagcaagcctgaga atattgggccgccttagaat 474 BY890860
CMFL036_M08_F gSNP02536 agcaagatcataggccagtca gctagtgaggctattgggctt 450 BY890909
CMFL036_M17_F gSNP02539 ttttggagagaaaagccctc catgcagccaacacaaaaac 416 BY890918
CMFL036_N13_F gSNP02543 ggagataatggctgcaaagc cttgcatctcttaaaggcca 479 BY890937
CMFL036_O03_F gSNP02546 ccaccattgttacccacgat gaagaagcagcagttggacc 506 BY890951
CMFL036_P03_F gSNP02551 catattctctgcgtgtggga ttgtccagacttccctttgc 426 BY890973
CMFL036_P09_F gSNP02552 tttcctcgcaccaaaatacc gcagaggaggacaccacaat 512 BY890978
CMFL036_P23_F gSNP02554 aacatccccatgaccttcag aatcacaccccttggtcttg 498 BY890992
CMFL037_A23_F gSNP02559 aaaatggctttcccttgctt aacatggttcgaattcctca 422 BY891016
CMFL037_B11_F gSNP02560 gaggttatcgcacggtgttt acgcctaacaagcgtcaagt 430 BY891028
CMFL037_B20_F gSNP02563 ttctcacccctgtacaaccc tctgggctggaagacagagt 463 BY891037
CMFL037_C12_F gSNP02567 gggttctgtgttggatttgg ctataagagggacccccagc 383 BY891053
CMFL037_E13_F gSNP02573 atgcaaacgcaacaaatgaa tttttgaaatgttgtgggca 531 BY891101
CMFL037_G15_F gSNP02582 gtgcaatcactgctccacat taagaacccctgagcttgga 423 BY891151
CMFL037_G24_F gSNP02585 tgcaagtgattgaaggatgg gacggcatcaaatccacttt 478 BY891159
CMFL037_I16_F gSNP02593 ccaaaagcaatccttcctga gcatgcattttcagtgacca 459 BY891199
CMFL037_I20_F gSNP02594 acaatggaaaccatagcgga tgcattctttgcatactggg 408 BY891203
CMFL037_J21_F gSNP02596 ggtgtggattttcaatggct cggtgcaggatgtatcattg 530 BY891228
CMFL037_K06_F gSNP02599 gctagcgttggcacaagttt ccttgcttggaatttggaga 453 BY891237
CMFL037_K09_F gSNP02601 atgtctggaacatcacacgg tcagtacaaatgggtcttcgg 312 BY891240
CMFL037_L01_F gSNP02603 atgactaggatgccaccacc caatccgtactgcaagattctg 370 BY891256
CMFL037_N12_F gSNP02608 tggtgtcgatggattttctg gataaattgcattgcccctg 398 BY891314
CMFL037_P06_F gSNP02616 agtcgcaaacatttcccaag cggtcataatcattggcaag 447 BY891354
CMFL038_B01_F gSNP02619 aagtcccgctccatttttct gaatcttgaaacagcggctc 380 BY891397
CMFL038_B13_F gSNP02621 gtcgaagaacggtccctgta ctttccatgcccttcacaat 442 BY891406
CMFL038_B20_F gSNP02622 aggaggaggagagggttcac tgccatttatctcgaccaca 495 BY891413
CMFL038_B24_F gSNP02623 accctagtgtaggggtcgct ggttgcttacctcctcctca 314 BY891417
CMFL038_C08_F gSNP02626 caaatggagacaaacacgga tctttgcactacgcaacctg 470 BY891425
CMFL038_D14_F gSNP02630 caaagggtgaaagaaacgga tcaatcacacagcaagcaca 447 BY891455
CMFL038_E03_F gSNP02633 gcaatctcaggagcctcaag agctttccaaaggagggaga 406 BY891468
CMFL038_F13_F gSNP02635 ccttcacatttcattcgcct cgtcctgttcaattccacct 452 BY891502
CMFL038_F14_F gSNP02636 tccattcttacccctgttcg tcagcactcctcccttttgt 444 BY891503
CMFL038_F17_F gSNP02637 gaaacctctttgaaggcacaa ggtgccactccatttaccac 445 BY891506
CMFL038_H07_F gSNP02643 caaagataacatcgcagggg ccactcaaattcccaccaac 470 BY891544
CMFL038_H08_F gSNP02644 agcgtgtggctttacttggt ttccacacaagtgttgctcc 506 BY891545
CMFL038_I03_F gSNP02647 cagatcaaggtgaagtcgca ccaaaacctgaacccacact 464 BY891562
CMFL038_J18_F gSNP02653 gggagcaatcgtctgtgact ccaggaaactgaccgttgat 479 BY891600
CMFL038_J19_F gSNP02654 gtcgactgaagtgagcagca agctggaagaaagcgatgaa 438 BY891601
CMFL038_K16_F gSNP02658 aatggcctctccctctgaat tccataaacgccacaagtga 484 BY891622
CMFL038_K18_F gSNP02659 tgatcttcgcggaaaagagt cgaggtgaaaacgaggaaag 488 BY891624
CMFL038_L07_F gSNP02660 cctccctcacaagatttttca cagccttaaatcctgtccga 472 BY891636
CMFL038_M07_F gSNP02666 atttccgtgtggtcattggt cccctgttctagagaaccca 444 BY891659
CMFL038_M08_F gSNP02667 aatccccacacattctctcg attgagcacaaggccaattc 467 BY891660
CMFL038_O01_F gSNP02669 tcctggtaaaattgaaaaatgtga gaaccccagctgtatcagga 449 BY891699
CMFL038_O08_F gSNP02670 atgggggacagcaagtacag caccatccgcatacaatctg 431 BY891706
CMFL038_O15_F gSNP02671 agaagaaacggctggtgaaa ccaggctgcacatactgcta 453 BY891713
CMFL038_O20_F gSNP02674 tttgcaacactacgcgctac acttggaggaagcatggcta 473 BY891718
CMFL038_P03_F gSNP02675 tttgccccatgtctctcttc caaccaaaaactggccctta 448 BY891725
CMFL038_P09_F gSNP02676 caggcatgacagcaaaagaa ccctccctcaaaagctgtaa 550 BY891731
CMFL038_P10_F gSNP02677 tggtgtcatgttcgattgct gatgtgggagcaggaatgtt 457 BY891732
CMFL039_A19_F gSNP02679 acttttgtgcaccagtccct ggaagaaaaatttcaacccca 340 BY891764
CMFL039_B18_F gSNP02680 catcaaagctggggttgaat aatctgatgggtctgcaagg 476 BY891786
CMFL039_C15_F gSNP02685 ctggaaagctgcaggaaaag acccgacacttgcatagctt 453 BY891805
CMFL039_C19_F gSNP02686 gcctctgtgaaatgccttgt tccagtatgtcgagggcttt 505 BY891808
CMFL039_D23_F gSNP02688 tttttctattgacgctcgcc ctgaaattcgcccattcact 447 BY891832
CMFL039_F06_F gSNP02692 atctggctctgcattcacct atccatgcagaagacttggg 447 BY891863
CMFL039_F17_F gSNP02694 tgagcgcgttacatgacatt tccctcagatccacttcacc 451 BY891874
CMFL039_H16_F gSNP02698 gagacgcgtgtagaacacca ttacggccaaaacaaaggtc 508 BY891920
CMFL039_J06_F gSNP02701 ctttcgtgtttggaccgagt ttcttcttgctcgccaaaat 459 BY891958
CMFL039_L13_F gSNP02706 tgttgccttgctttcagttg acagtctggctttgtcccag 475 BY892011
CMFL039_M22_F gSNP02712 tctgggtagtggcaaacaga cgtggaacgaagctccttag 550 BY892042
CMFL039_N10_F gSNP02713 agatgggaggttgccttctt tttcagcaacagtactgcatca 435 BY892054
CMFL040_A22_F gSNP02721 caatcctcgaccagggataa acaaagttcgctaggctcca 413 BY892135
CMFL040_C15_F gSNP02726 gatgaaggcactcctcgttc catcatgcccattgattgag 495 BY892175
CMFL040_D16_F gSNP02729 tgccattgtggagaaaatga tctttgagttggagttcggc 390 BY892199
CMFL040_E09_F gSNP02732 gggaaaatttttgaaaaccca aaaatcgcaggcattctttg 415 BY892216
CMFL040_F12_F gSNP02739 tggagcagttccctgaatct tcgaacacttgatgtccctg 417 BY892242
CMFL040_F24_F gSNP02740 cctcgttgtagccttctcca tcctcgactgctctttcctt 391 BY892254
CMFL040_G16_F gSNP02743 tgaaaatgttttgaaggggc gaggcagcgattcgatagtc 538 BY892270
CMFL040_H14_F gSNP02748 atggtggatcagctgagagg gaaggccacaaagaagcaag 490 BY892291
CMFL040_H18_F gSNP02749 ccaatgagtctgttcaggtcc ctgctgttccagatgcgtta 336 BY892295
CMFL040_I23_F gSNP02750 tggcttgtttttctaatggg caatcgaacccgaaaagttg 433 BY892323
CMFL040_J05_F gSNP02751 gctccatcctcaacctatgg tgagagaagtgagggaggga 453 BY892328
CMFL040_L06_F gSNP02760 ggaggcgacaaaaggagttt cgaatagacgaaccccaaga 451 BY892374
CMFL040_M02_F gSNP02764 gagcgttctccgagtcattc gcaaaggctccctccataat 512 BY892394
CMFL040_M08_F gSNP02766 aattcaatcgggaatgttgc atccctgctcctgttgtttg 470 BY892400
CMFL040_M13_F gSNP02767 tgaatctgccttttgtgtgc tgttgctatgagatttctgcct 381 BY892404
CMFL040_M21_F gSNP02769 ttgtgcctctccaccatttt gccttcttttgtagaccccc 454 BY892411
CMFL040_N10_F gSNP02771 gtgcctgaggagaacagacc ccctaacccctctgctaacac 465 BY892423
CMFL040_O03_F gSNP02773 ttgctggaagtgagagggtt caaccttcatccgctgtctt 447 BY892440
CMFL040_O05_F gSNP02774 agttgacctgctgatgggac atcccctcgactctcgatct 333 BY892442
CMFL040_P11_F gSNP02777 ggctactgtttaccggttcg gccgcctgtaaatactgcat 459 BY892471
CMFL040_P12_F gSNP02778 gctgtttcctactgccatcc ctcgtctttactcatccccg 379 BY892472
CMFL041_B22_F gSNP02785 cagtgaatctcaagatgcaaaga gttgatggtgttggggaatc 450 BY892529
CMFL041_C08_F gSNP02786 aagtataccggaacccctgg ccaggtaagcaatgaacggt 465 BY892539
CMFL041_E06_F gSNP02790 ccatgttcagcagcaatatca tgcaacatgttcagagaagca 431 BY892583
CMFL041_E10_F gSNP02791 tgccagatttccattccttc cttcacttccatcaggcaca 413 BY892587
CMFL041_F18_F gSNP02793 tcaggtctagttttgcgcct tgctcatctggcattgtagc 483 BY892619
CMFL041_H05_F gSNP02796 ttaggctatggcaggaggaa tgcagtccacattcttgtcc 477 BY892652
CMFL041_H06_F gSNP02797 gaagaaggtccgtgttggaa caaaacactgggaaatccgt 478 BY892653
CMFL041_H17_F gSNP02799 gggaaaatttgtaaagcgca tcacggttggggtttctaag 493 BY892663
CMFL041_H22_F gSNP02801 aggctgtactttcagggggt gagcccaaaccatttgacat 463 BY892668
CMFL041_J08_F gSNP02804 aatgaaagtgggggtacggt aggacaagtccgacatggag 384 BY892702
CMFL041_J12_F gSNP02805 gacgatggttacatgggtga gctgagacagtgcagctttg 508 BY892706
CMFL041_L04_F gSNP02811 cgggttcaaccagaatgact atgttgccattgttgattgg 425 BY892745
CMFL041_M04_F gSNP02815 acctcattcccgaaactcct gagcttcttggcaactttgg 438 BY892768
CMFL041_M18_F gSNP02818 caaccccaccaattctgtct tgaacccaaatgatccttcc 454 BY892782
CMFL041_M23_F gSNP02820 gaacgtgcagcattctttga caaacaagaggagactgggg 494 BY892787
CMFL041_N20_F gSNP02822 aagcaccggaagagagtgaa aagaaaaggcactgcaggaa 490 BY892808
CMFL041_O09_F gSNP02823 gctgcgaaagtatcatgcag atttcccaggggtactgtcc 531 BY892821
CMFL041_P11_F gSNP02826 tttcttgaagccatcaaaactg tgaaacttggttgttgcgaa 474 BY892847
CMFL042_B10_F gSNP02833 gggatttgatgtagagggca ggaatccttggacagcttga 392 BY892891
CMFL042_B12_F gSNP02834 atctcctcctctgtttgcca gccgaaggaactatgcagaa 385 BY892893
CMFL042_D07_F gSNP02839 agactccgattcccttggtt gtatgctcagctggggagtg 450 BY892932
CMFL042_D22_F gSNP02840 gacgcttcccagatccatta gaccttgaatcggaacgcta 461 BY892946
CMFL042_E03_F gSNP02841 gcaagggaggagttaagcaa aaccttgcttcatgtccgag 437 BY892951
CMFL042_F12_F gSNP02847 tggacgaggatttatggctc cttccaaaattgcgctgagt 411 BY892983
CMFL042_G12_F gSNP02850 ggaggaggaggaagagagca agataatcataagggggcgg 438 BY893005
CMFL042_G22_F gSNP02851 agctaattgcgctcgttgtt tttcactaagagtcccgcgt 410 BY893015
CMFL042_H23_F gSNP02854 tgtgtatcggacctgtttgc ccactcaccgcagtatttga 461 BY893039
CMFL042_J01_F gSNP02858 ttgttgtcaggctctggctt taaaaatgcaggggaaatgg 482 BY893064
CMFL042_M03_F gSNP02863 ttttcgagcctgcaaaagtt ccagtagcagggagtcagga 369 BY893130
CMFL042_M05_F gSNP02865 atgctgtgccaaacaacaag ttgctctccatgcttgctaa 447 BY893132
CMFL042_P07_F gSNP02871 tttgctagcccttgcatttt atcggtctgcagggttttc 351 BY893204
CMFL043_B11_F gSNP02874 caaacaacgcatctggaaga gtgcatcctccagtctgtca 489 BY893251
CMFL043_B13_F gSNP02875 aagggcaatgacgaggtaca aagcactagacatacgccgaa 432 BY893253
CMFL043_B18_F gSNP02877 atttcaacaccccaacaacc ttcttcaccaagccatcctc 336 BY893258
CMFL043_D11_F gSNP02878 atgcattgttcctttcccat cgcccttcagttctttcttg 429 BY893296
CMFL043_E15_F gSNP02880 ggatcaggtcctcctccatt gcagaacgagttccaagagg 371 BY893324
CMFL043_E23_F gSNP02882 atataaacaccaatggcggc cagctttgagtccaaccctc 414 BY893332
CMFL043_F22_F gSNP02884 ttcagtccaggctgacaatg gatgggggaatctctggttt 439 BY893355
CMFL043_G17_F gSNP02886 caagtcaaatttggtatggca tgaatctgttgccactgacg 360 BY893374
CMFL043_H06_F gSNP02887 gatagtccgtgacgagggaa tcgacaactgcatggaaaaa 527 BY893386
CMFL043_H09_F gSNP02888 tcagtgcttaatccagtgcg caattcgttttgaactgcca 405 BY893389
CMFL043_H23_F gSNP02889 ttgcttttggtttcaatccc gaggcaacagtaaccaagca 437 BY893402
CMFL043_I12_F gSNP02890 aaatgagatgcaactgatggc tttaatgcatgaatggaagtgc 436 BY893415
CMFL043_J04_F gSNP02892 atcttatcccatatgccggg tgagattcctctgtgcaacg 400 BY893431
CMFL043_J23_F gSNP02895 agcttctgcaattcaatcca caagccctcccataacaaga 432 BY893449
CMFL043_M03_F gSNP02899 ttaattccttgcgttcccac agttacccagaatgcatggc 438 BY893499
CMFL044_A02_F gSNP02906 gatatgctcggagtcgcaa aagattggctccaacacctg 372 BY893591
CMFL044_A11_F gSNP02908 tccgttactcaggttttggg cctgaaatcactgcactcca 383 BY893600
CMFL044_B23_F gSNP02910 tatcttggacagggcaaacc agcccccaaatttaacaagg 459 BY893632
CMFL044_D05_F gSNP02912 aggcctatgaagcgactgaa cctgacagcagggacatttt 439 BY893659
CMFL044_E02_F gSNP02914 ccaaagttcatttctcccca agcctggcataattctctcg 433 BY893680
CMFL044_E04_F gSNP02915 tttgtttttctggggtgtcc tgtcatttttatggattaacaggg 416 BY893682
CMFL044_E08_F gSNP02916 gctgtctcttttccttctcca atgttgaccatgcagcagag 396 BY893686
CMFL044_E15_F gSNP02918 atgcacaaataagccggttc cactctgcttccctacccag 457 BY893693
CMFL044_E23_F gSNP02921 cgtcaacatgctttcagagg attggtgctccaccctacag 460 BY893701
CMFL044_E24_F gSNP02922 ttgagcacgacttaaaacttttctt gtgaccagctcccagttcat 381 BY893702
CMFL044_G16_F gSNP02926 gaaggaccttgtgcatgtgtt aagctcccaagcacaaagaa 478 BY893739
CMFL044_G19_F gSNP02927 tttggcattaaaagggaatg tgaaaatacctcgaggggaa 364 BY893742
CMFL044_H21_F gSNP02929 ttcgaccctcaattttgtcc gcagagcttgctgagtttcc 487 BY893766
CMFL044_I11_F gSNP02931 ttggatacatgaatgcgtgg aaagagcaatggcatgaagc 361 BY893778
CMFL044_I12_F gSNP02932 gagcttcccaggaggacttt ggccagcagagaaaatcttg 451 BY893779
CMFL044_K17_F gSNP02937 ctcaatttggccaagcattt ttcaccatcaatccaagcaa 451 BY893831
CMFL044_M18_F gSNP02943 ttttcttctggatcggcgta gctccttcactccattcacc 499 BY893874
CMFL044_O08_F gSNP02946 ttccttattccccaaaaccc attaccggccatgaacacat 448 BY893907
CMFL044_O17_F gSNP02947 aaggcatccgtattcgtgag ccttcttcaccaatgcatca 459 BY893916
CMFL044_P01_F gSNP02948 gaggctaaaattgcaggtgg tggaacatacactgtcccca 407 BY893924
CMFL045_A24_F gSNP02955 gtacgggaacatggcaaaaa cacatggaaggaaacctcaaa 484 BY893970
CMFL045_E02_F gSNP02964 gcttcaaaaccccaatttca ataatttagcagctccgcca 436 BY894043
CMFL045_E23_F gSNP02967 gttgaggcaaaccacgaaat aattcaacgctgtctctggg 462 BY894062
CMFL045_G21_F gSNP02971 tattgcgagaatgaaagggg tcaaaaatctgcctgcaatg 474 BY894106
CMFL045_G24_F gSNP02972 aagtattgcgcgatgaatcc gcacttgtctcgggttgaat 466 BY894109
CMFL045_L24_F gSNP02982 acttccatgcaagcttcgtt tgcagcatacgcaagaccta 392 BY894220
CMFL045_N22_F gSNP02985 agggtctccattgcagtgtt aagtaatccgccatccttcc 438 BY894266
CMFL045_O02_F gSNP02986 ccatagttgtgaagagctggc gttgcccttccacagaatgt 505 BY894270
CMFL045_O05_F gSNP02987 agcagatatgcctgattgcc gagctgctgaaagtcaagcc 301 BY894273
CMFL046_A11_F gSNP02999 tggctcatagaaaaccggac acctccagagtcgcattgag 464 BY894323
CMFL046_C06_F gSNP03003 caggattaatggcagggaga catttcttagcgggaagctg 314 BY894365
CMFL046_C12_F gSNP03006 ctggagatgccagaatccat aggaataggcccaaaccatt 439 BY894371
CMFL046_C14_F gSNP03007 actctgagcagggtggaaga agcaccagcctttgaaagaa 422 BY894373
CMFL046_D16_F gSNP03009 aattggcagctgtgttcctt tccttgaaccattcgatctg 387 BY894392
CMFL046_E10_F gSNP03010 ctgccgaggacacttcagat cctttcagataatggcccaa 369 BY894404
CMFL046_E16_F gSNP03011 atgcactctaaccctcccct gaaggcatggtttggtaagg 358 BY894409
CMFL046_F12_F gSNP03012 gaggttgaatttgagcaggc ttctaaagagcgtctggagtga 319 BY894429
CMFL046_F21_F gSNP03014 ggaaaagcagagtcacaggc aactgaccgttcattttgtgg 369 BY894437
CMFL046_H02_F gSNP03017 taggattttgtgccggaaac tcactccccctgctgtaaac 487 BY894465
CMFL046_J02_F gSNP03020 ttgaagagtgcatcgcagac tcaagaaatgaagcaatgcg 462 BY894511
CMFL046_J23_F gSNP03025 tccaaggtctttcacggttc agtaacaaacggccttgcag 361 BY894531
CMFL046_L18_F gSNP03028 tggtcccccagctctaacta cttgtggagcgaaaggaaac 413 BY894570
CMFL046_M12_F gSNP03030 gaaaaccctaatcccggaaa tccttttggtttcctgttcg 356 BY894585
CMFL046_N15_F gSNP03032 ttaccggaccgacagttttc catcatcatggaacatggga 357 BY894609
CMFL046_N17_F gSNP03033 tgagtgtgaaattttgtcatgaag tttgggacgaccttccatag 394 BY894611
CMFL046_N18_F gSNP03034 cgcaattttgagcaaaacaa cgttcaaattcccacaggac 447 BY894612
CMFL046_P04_F gSNP03037 tggccttctgtgcttctctc agctgattgaggtgaggtgg 375 BY894646
CMFL047_A14_F gSNP03044 agagaggaaacgctatggca tcaggaagcagttcccactt 414 BY894677
CMFL047_B03_F gSNP03046 tacgatttttgaagaggcgg ccaatcgacgaaacctgact 540 BY894688
CMFL047_B24_F gSNP03049 cgctttcagtggggtatttc tcctttgaatcctcaatgcc 387 BY894709
CMFL047_E17_F gSNP03057 ccctggagatttgaacttgtg aggccttcccaacaagaact 416 BY894770
CMFL047_G09_F gSNP03063 aggatgccatatccagcaag tcctctggagttctttccca 455 BY894808
CMFL047_G16_F gSNP03065 ctgtggccaaaacaaggaat ttggcaaaataacaatggca 372 BY894815
CMFL047_H10_F gSNP03070 tgctggtaatcttggaaggc tcgcatgctctgaccaatac 527 BY894833
CMFL047_J01_F gSNP03077 gtccaatcccaccatcaatc cggccatttagtccgataag 436 BY894868
CMFL047_L05_F gSNP03081 agatatccatcgtccgcatc tgggaactgctttctttgct 321 BY894914
CMFL047_L13_F gSNP03082 attggctggcagttacgaag cgctgcctgtactgctactg 419 BY894922
CMFL047_M18_F gSNP03083 ctcccgatgttaatgcgtct tcccaaagacctgtcattcc 420 BY894950
CMFL047_N03_F gSNP03084 gaaggatggattggggattt tgagattatttttccatccattg 474 BY894958
CMFL047_N20_F gSNP03089 gagcagccatggaatcattt ctggatctgagacttcacgct 494 BY894975
CMFL047_P13_F gSNP03094 ttttccaacactaggcattcg cagggccagacaagaacagt 305 BY895016
CMFL048_A19_F gSNP03098 ataaatgtgcattgggccat gcagccatagggtgaatttg 365 BY895043
CMFL048_B08_F gSNP03100 tcgtggactaatgccactca catgggaggtaggtgatgct 418 BY895055
CMFL048_B15_F gSNP03102 gaggaggtcacgagttccag caagcacggattcctcaaat 399 BY895062
CMFL048_D03_F gSNP03106 caacgcggaaccctaataaa gtctgaatagccacacgcaa 394 BY895094
CMFL048_E03_F gSNP03110 aatggttttgcagagcaagg ctggatcccagtctccacat 389 BY895116
CMFL048_E09_F gSNP03111 gggagcccaatcggtatatt ttcttgctccttcctatccg 472 BY895122
CMFL048_F11_F gSNP03114 ggacaaagagacaaacgtagca cgaaggtagcatccctcaag 405 BY895146
CMFL048_F13_F gSNP03115 gatttgcatgaaagcccatt tttgcaatctgcagttcgat 401 BY895148
CMFL048_I15_F gSNP03121 cagaagctttggacagtgtatcc gcttgagccaactgcacata 425 BY895217
CMFL048_I16_F gSNP03122 aaccagtaatgcggatggag gacgatttacctttgccacc 375 BY895218
CMFL048_I19_F gSNP03123 ggcaagcaaaataagcgagt tttgcaacagttgagttcgc 407 BY895221
CMFL048_K13_F gSNP03124 tgtgaggagaaggcagttga aacgggtctgacttgctttg 422 BY895260
CMFL048_L24_F gSNP03126 ttcaatttgggcggtttaag acctcaacgagatcaatgcc 438 BY895291
CMFL048_M15_F gSNP03128 aggaaatcaggattgttggc atggcgtagggagtgagaga 409 BY895306
CMFL048_O06_F gSNP03136 gttctgctggaagggtttca gcaagaatccttgagcagttg 411 BY895343
CMFL048_P03_F gSNP03138 attttgccaggcttcaaatg atttcattttggaaatggcg 377 BY895364
CMFL048_P15_F gSNP03139 tgaggctgattttccagacc aaaccctcgggaagaacact 471 BY895376
CMFL048_P16_F gSNP03140 tttctcagcatcacaggacg tgcttctcagcttctccctc 384 BY895377
CMFL049_B22_F gSNP03146 gcggcatcaacaagctacat tgtcatgcattgaagtccgt 359 BY895430
CMFL049_C13_F gSNP03147 tgaaatgagcagcaaacctg aatcatcatcccactctccg 327 BY895445
CMFL049_C21_F gSNP03148 tctcctccactcaacatccc gaatggtctgaaggcaaagc 454 BY895453
CMFL049_D07_F gSNP03151 ttctgaggtcctgggatcat agcctgtgctactaccaaacaa 351 BY895463
CMFL049_E14_F gSNP03153 tggttttgtttgtatagatgcg cctcatgactctcaccagttca 350 BY895491
CMFL049_F24_F gSNP03161 gcatactggccttccacaac gcgaagatgggcatagagtc 450 BY895523
CMFL049_H12_F gSNP03163 cgagacaaatcgagcacaaa ccttgagaacccattcgaga 422 BY895551
CMFL049_K04_F gSNP03171 tccgagggactttagggttt acgccagtatcgtctccaac 389 BY895607
CMFL049_K17_F gSNP03174 cccatttaagtcagccctca gggaggctagatcacactgc 303 BY895620
CMFL049_L20_F gSNP03177 ccaaagaagcgatccaagaa tttttccagcgttacccaag 375 BY895645
CMFL049_M08_F gSNP03181 atcgattgttgctctccctg aacggacgcaattcttcaac 419 BY895654
CMFL049_N11_F gSNP03186 ttcgtcgtgcgatacttcag ccatcatgaaaagcccaact 459 BY895677
CMFL049_O10_F gSNP03190 accgagaaggcagctcacta gagatctcttcaggcgcaaa 409 BY895699
CMFL049_O23_F gSNP03191 ggatttggagaagctgggtt ggtgaatgcgtcacgaacta 429 BY895708
CMFL050_A21_F gSNP03193 tcaaaattgtgggatttgcc tagggctctcctgatgttgg 386 BY895748
CMFL050_B05_F gSNP03195 ttgaggacaaaggatgggag gcattgcagagaggaacaca 454 BY895756
CMFL050_B10_F gSNP03196 tgtctttggaaattgcaggg catatgcaggtttcctgttca 463 BY895761
CMFL050_B23_F gSNP03199 acaaatgagaaatgcggtcc agaagctcatggaaaaggca 458 BY895774
CMFL050_C19_F gSNP03201 aatcgaaccgtggtcttctg gcgtactgctttccagatcc 534 BY895793
CMFL050_F22_F gSNP03206 agaaatccagaaaagggcgt gccttcaacccttccttttt 504 BY895864
CMFL050_I13_F gSNP03212 tcaaacggttacagggaagg gtcacatgtacctggcgttg 448 BY895922
CMFL050_L01_F gSNP03214 ctcctcctcagatggcaaag gatcaatgcgtggattttcc 399 BY895980
CMFL050_L09_F gSNP03216 tcctcttcctccactcctca cagaagtgccactggttgtc 534 BY895988
CMFL050_L24_F gSNP03217 acagattcccacaatgcgat taaacccatccccatcagag 326 BY896003
CMFL050_N23_F gSNP03222 cccacaaaaagttgtgtgaaga gcccaaacatggaacaaaaa 466 BY896047
CMFL050_O18_F gSNP03226 aaacaagaggcaccgaattg ctctgcggtatccaccaaat 412 BY896061
CMFL051_A02_F gSNP03229 aattgtttcaatcttgcggc agaagcttcatcgcctgtgt 399 BY896093
CMFL051_A06_F gSNP03230 tgcttgagaagacagtcgga gtggccctgatgaccttcta 422 BY896095
CMFL051_E16_F gSNP03239 gccttgcagcccttaataca ggtgtgtgtaggatggtccc 428 BY896188
CMFL051_F19_F gSNP03241 ataagcaagagaggcggttg tatgtttgtgcatttcccca 522 BY896215
CMFL051_G15_F gSNP03242 tgaaagccaccacataccaa catcgaagccgctactatcc 401 BY896235
CMFL051_G22_F gSNP03243 ttgcctttttatacggagcg aaatttgccgttcagaccac 400 BY896240
CMFL051_H03_F gSNP03244 ttgcataaccagaatggcac cccaataatggaccaaccac 429 BY896245
CMFL051_H20_F gSNP03245 cttgccagatcttggtgtga cctcaagggaattaatgcga 467 BY896261
CMFL051_J17_F gSNP03249 aggacttggcgactgcatac gctgaagaatctcgccgtaa 490 BY896303
CMFL051_K23_F gSNP03252 aagctagaagggcttgaggg cttatctccacacttgggca 396 BY896329
CMFL051_M22_F gSNP03258 tctggtatgccaacgattca taccataagtcccgtttgcc 315 BY896371
CMFL051_M23_F gSNP03259 aagcagcgttctgtaaagcc gtctccaccatcttcgcact 423 BY896372
CMFL051_N24_F gSNP03264 ttttctgtgtagaagcgacctg gaaagggtttcagcaagacg 431 BY896397
CMFL051_O04_F gSNP03265 caattcgacaacagtgtggg acgagccgtacaacttccag 407 BY896401
CMFL051_O11_F gSNP03267 atatatatgggggcttgggc tattgcgatgcaagaaccaa 392 BY896408
CMFL051_O18_F gSNP03268 tccagaatgcttcttgtttcttg acacatgtgatcatgctagaggtt 380 BY896415
CMFL052_A09_F gSNP03273 gcatccacatctatttctggc ccttttcccttagtcaccca 421 BY896450
CMFL052_A15_F gSNP03274 attatgatccagcaacggga acggcaccaccagtaagaat 441 BY896453
CMFL052_B17_F gSNP03276 cagggagaaagacaatggga cacaagcagtataagccgca 446 BY896476
CMFL052_C14_F gSNP03279 acggaaggtgaaaactgtgg cagaagagatccaccggcta 526 BY896495
CMFL052_F09_F gSNP03284 ttggcaagtcattggtgttc ccaactagcagaagagccga 525 BY896555
CMFL052_I04_F gSNP03294 caatcacccagtggctaagg tcgccttgattgtccttttc 305 BY896617
CMFL052_I09_F gSNP03295 tgacttgcaacagcaaaagg ccttttgtccaaagacccaa 407 BY896622
CMFL052_I11_F gSNP03296 tccacagagcgttagaacca tgggtaagcaaatgcaacaa 374 BY896623
CMFL052_K05_F gSNP03303 cttcctgaagaagcggaatg gctcgctctctgagcttga 379 BY896659
CMFL052_K22_F gSNP03304 tgattgtcaagggagaaggc agagtgtgcggcgataagat 400 BY896675
CMFL052_L14_F gSNP03308 gatcctccccagaaacttcc ttgccattgattaccactgc 498 BY896690
CMFL052_M06_F gSNP03310 tcctttcgttttcttgcctg ggtctttgccagtgggtact 443 BY896703
CMFL052_M12_F gSNP03312 gatgcgataatggagggaga aaattgcatctcagaaaccaga 519 BY896709
CMFL052_N07_F gSNP03314 aaacaccttctgtcggctct tgagtggattggaaaaaggg 436 BY896727
CMFL052_P10_F gSNP03319 cggtgaatgcgaataactga tcgtctgccattataagctgc 461 BY896775
CMFL052_P18_F gSNP03320 atgtgcatagtgcggattca cttctcaccacccacatcct 468 BY896782
CP10013_BJ936656 gSNP03324 TTGACAGTAATGATGGTTTTGTTG CACATGCTTGCAGTGAGACA 457 BJ936656
CP10091_BJ936785 gSNP03330 TGCGACTTCTAGTTTTGGGA TCCAACAAAACCATAAAACGG 402 BJ936785
CP10214_BJ936951 gSNP03343 CAGAAGTTCTTTGAGCATGGC ACAGGCAGCTTGCATGATCT 399 BJ936951
CP10234_BJ936981 gSNP03345 GTCAAGAAGGTGCTACCCCA CGAGGGTTTGAGTGAAAACAA 402 BJ936981
CP10268_BJ937028 gSNP03347 AGAGGAGATGGGGAAAATGG ACTGCACTCAATCATGCGAG 464 BJ937028
CP10272_BJ937035 gSNP03348 TGGAGTGCACTAAACATGCC ACAATTATGGCGACTCAGGG 420 BJ937035
CP10303_BJ937088 gSNP03351 CACGTTTTGGTTGGGGTAAG TGTTTTCACAGAACCATTCACA 465 BJ937088
CP10482_BJ937346 gSNP03356 TCCTATTGCGGGATTGAGAC TGCACAATGTTTTAAATGGCA 380 BJ937346
CP10558_BJ937453 gSNP03358 ATCACTGCCAGAGCTCACCT AAAAGGACACACACCAAGCA 325 BJ937453
CP10597_BJ937507 gSNP03362 TGTGGTTCATGGATTCTGGTT TCAATCGTGCAGTCTTGTCA 382 BJ937507
CP10748_BJ937772 gSNP03375 ATCGAACAATGCTCTTTCGC CCTGAGGTTCTCCCTCTCCT 339 BJ937772
CP11081_BJ938309 gSNP03401 GGGTTGGTGACTTCTGCATT CCAAGCAGTAATGTGGGGAT 410 BJ938309
CP11931_BJ939666 gSNP03479 CACCGAGTGGGTGAGTTTCT TTGCTGCTATTTCTGCTCCA 435 BJ939666
CP11934_BJ939672 gSNP03480 AACGGTTCTGCCTTCACATC TGTGGGCTTTATCCCAGATT 511 BJ939672
CP12004_BJ939798 gSNP03482 CAAGGCACCCTTGTCTCTCT CATCGTGCAGCCTGTGTG 367 BJ939798
CP12027_BJ939841 gSNP03483 TCTTCTCTTGGACGCAGAGG AATGCCAAACTTTGTCCCTG 375 BJ939841
CP12043_BJ939870 gSNP03485 CCATGCAGTTGTATCGGATG CCCTCTTCCTCATTGTCTGC 472 BJ939870
CP12073_BJ939921 gSNP03487 TCATGCAATTCCAGTGAAAGA TAGATCCCTAACAGTCCGGC 328 BJ939921
CP12076_BJ939927 gSNP03488 TCTCCGATGTTGTTCAGCAG TCATTCAAGATCGGAAGTTGT 427 BJ939927
CP12095_BJ939964 gSNP03491 ATTTTGGAGGCCATCAGTTG CCCCTATTCTTCTGTTGCCA 463 BJ939964
CP12121_BJ940007 gSNP03492 CATTTCATGCCTTTTGACCA GTTCAAATCCCAAAGGGACA 371 BJ940007
CP12152_BJ940056 gSNP03495 TCAAATCCCTGCTTAGAGCC ACAATTTGCAGGGAACTCCA 416 BJ940056
CLFL001_B24.f gSNP03509 TTTTTCTTTATGGAAGCGCC CCTGGCAAAACAGTGTGAAA 467 FY225528
CLFL001_D02.f gSNP03511 CCAGATGCATTGCAGGATTA GGATTTTGGCTGTTGAAGGA 455 FY225553
CLFL001_D06.f gSNP03512 TAATCAACGTAATGCGCAGG CATTTTATGGCAGATGACGC 437 FY225557
CLFL001_D16.f gSNP03515 CAAAATCGCAGAGATGCTGA TCCACCATTTTTAGGTTGCC 465 FY225567
CLFL001_E04.f gSNP03517 CTGGCTGTCTTTAATGGCGT ATGTTCGAATCCCACAGCAT 448 FY225579
CLFL001_F08.f gSNP03521 GGAGATAGCCCATCCTCCTC TGCTGGGTTCTTCATCCATT 495 FY225607
CLFL001_F15.f gSNP03522 CATGGCTTCCTCCTCATCAT CAGATTTGAGCGCCTCTTTC 440 FY225614
CLFL001_F19.f gSNP03523 GGCTCCCGTTCTTTGACTTT CTCCTAAAGACCCACCACGA 453 FY225618
CLFL001_G08.f gSNP03524 CAGCTCTCAAACATGCATCAA ACCATCCAAAGGGGATACCT 432 FY225631
CLFL001_G13.f gSNP03525 TGATGAAGATTGCATCACTCG TCATGGCTAGATCCAAACCC 420 FY225636
CLFL001_H03.f gSNP03528 TGGCACGTATTTTCACAACAA TCCTCTCTGCCCTGTCTGTT 400 FY225649
CLFL001_H19.f gSNP03529 GAGGAAAAATGAAGAGGCCC AAATGGCAGCGTCAGAACAT 469 FY225664
CLFL001_I15.f gSNP03533 GCCTCATGTGGGATGCTAAT TCCTCTTTCAGACCGTAGCG 422 FY225684
CLFL001_I20.f gSNP03535 GTCACTGAGATCGAGGCACA GGTCGAGCCCTTTTCCTATC 415 FY225689
CLFL001_J22.f gSNP03537 GCTCAACATTTGTCGCAAGA TCCTTAAGCTGGTCCCATGT 450 FY225715
CLFL001_K22.f gSNP03543 TTTTCGCCTCATCTGGCTAT AACCAGGGAAGCCAAATTCT 448 FY225739
CLFL001_L11.f gSNP03546 CCTCTTTTCCAATGCCCATA TGTGAGGAAAAGGGGCAATA 438 FY225751
CLFL001_L18.f gSNP03549 CCGGACAAAACTCAGAGTGG TCGGCAAATACATTAAGCCC 514 FY225758
CLFL001_M11.f gSNP03551 GGCTCTGCAGGATTCTTTGA GCAATCATTGGCACACAAAC 438 FY225774
CLFL001_M14.f gSNP03552 ATTCGCTTGCCAAAGACATC AGCCGTCAGAAGCAAGAGAC 444 FY225777
CLFL001_M16.f gSNP03553 TTGGCTGTAGCATCGTCTTTT TCATAATGCCCTTAAAAGATTACAAA 468 FY225779
CLFL001_M19.f gSNP03554 TGGCCATCCCTGTGATAGAT GCCAGGAACTTGTCTTTTGC 336 FY225782
CLFL001_M24.f gSNP03555 GCCAGTCGGCTTATAATGGA GTGGTTTTCCTTCTGCCTCA 455 FY225787
CLFL001_O18.f gSNP03559 GGCTTCTCCTCTGCATTGAG CAATTCTCTTCTTCCGGTGG 480 FY225828
CLFL002_A03.f gSNP03563 GGCTCTCAGGGATTTCTTCA GTAAGTCGAAGGCCAAGCAG 437 FY225861
CLFL002_A08.f gSNP03565 TGAGAAGGCTGCTGGAATTT CCAAACGGTTGATAAGTGGC 425 FY225866
CLFL002_B19.f gSNP03573 CTGTGAAATGGGCAGAGGTT TGCGGACTGACTGACTTGAC 520 FY225899
CLFL002_B21.f gSNP03574 TGTCATGGGCTCTGTTTTCA AACTCCCCAGTATTCCCCAC 472 FY225901
CLFL002_C03.f gSNP03575 TAACTTTCAGCGCTATCGGG CCAAAGCTGGCTGTGATTTT 439 FY225907
CLFL002_C04.f gSNP03576 TATGCTTATTCTCCAGCGCA ATTTTCGAAGCTCTCCCACA 418 FY225908
CLFL002_C08.f gSNP03577 CCTTTTGCGTATCAAGGCAT TCTCATGTTTCCAGTCCACG 430 FY225912
CLFL002_C20.f gSNP03578 AAATCATGAGGAATCCGTGC TTTGCAGAACAGAAGCAACAA 420 FY225924
CLFL002_D03.f gSNP03579 GGGAGGAGGGCGTATCAGTA GTTGCGTGCGTATAGGAGGT 482 FY225930
CLFL002_D21.f gSNP03581 AAAGAGGCGCTGAAGACAAG ACGCTGCGTTTGTCAGTACA 422 FY225948
CLFL002_E20.f gSNP03584 GTGCTCGGGGATGATATGTT TTTGATGGATGTCCAAACCA 421 FY225970
CLFL002_F22.f gSNP03588 ACTTCCCCCGTTGAATTTCT TGCCTGAGAAACATTAGGGC 431 FY225995
CLFL002_G01.f gSNP03589 GTGATTGCGCACGTAACAGT GGCGGTGAATTCTGTGAGTT 443 FY225998
CLFL002_G10.f gSNP03590 GATTGCAAGCAACAAACCCT CCAAAACAGAATCTCAAGCCA 507 FY226006
CLFL002_G14.f gSNP03592 GCCCAGTCAACGGTTCTTTA ATCATCCGGAAGAAGGGACT 464 FY226010
CLFL002_G24.f gSNP03595 CGTAGACAAGGCACGTGAAA CTTCCGCAGCAATAATTTCC 419 FY226020
CLFL002_I09.f gSNP03599 CAATCTCAACGTCTCCCACC CCTGAAGCCCTGTTCTCAAA 503 FY226053
CLFL002_J12.f gSNP03602 TAGTTACAGAAGGGCGGCTG GCAGCTCTGTGTGCTTTGAG 429 FY226079
CLFL002_J24.f gSNP03605 TCCAATTCAGGGTGTGTTGA CCCACAAAAGAAGGACCAAA 498 FY226090
CLFL002_K06.f gSNP03606 ATTGCATTTGGAATCTTGGG GCCTGTGAAAAGGGTCTCAA 464 FY226096
CLFL002_M13.f gSNP03613 GGTCAAAGCAACCCCACTAA AGGTTTCCGTCAATCTGTGG 476 FY226150
CLFL002_N02.f gSNP03617 CGAGGAGGCTTTCATCTTTG TGCTGTAATTGTGGTCGGAA 521 FY226162
CLFL002_N13.f gSNP03618 GTAAACGCTGGAACAAGGGA TCTTGCATGTCTATGGTGGC 454 FY226173
CLFL002_N19.f gSNP03619 TTTCTTTCTCGGGGTCAATG ACATTCCTGCGAACCATTTC 423 FY226179
CLFL002_O21.f gSNP03626 GGGACTGGTCTCTGCAACTC CTGGAGTCTTTGGCAGAAGG 507 FY226205
CLFL002_P07.f gSNP03629 GCTAGCCAAATTGATCAGCA GGAAAACAAGGCCGTCATTA 528 FY226215
CLFL003_A24.f gSNP03632 GGTCCTCGCTCTTGTGCTAC TGATCACAAGCTCCTCGTTG 430 FY226256
CLFL003_B14.f gSNP03636 CCATTCACTGTTACCCCCTG ATGTGCTCTGCCTCTCACCT 421 FY226270
CLFL003_B17.f gSNP03637 CACCGCTTAATCCTCAGGTC CATTTTGGGGAGTGCAAGTT 440 FY226273
CLFL003_D02.f gSNP03640 TTTTCTTCCTTGCCATCACC TGGGGAAGTAGACCGAATTG 417 FY226306
CLFL003_D19.f gSNP03644 GCTAGCCAAGCCCAGTACAC TTCGCCTGCTTAAGCTTCTC 445 FY226322
CLFL003_D20.f gSNP03645 TTGTTCTACGATTGGAGGGG CGTGAACAGACATCAACGGA 427 FY226323
CLFL003_D24.f gSNP03646 TCTGTGATTCCGAGCTCCTT TGACTTCTTGATTTTGGGGG 509 FY226327
CLFL003_E24.f gSNP03650 AAGATTCAATGGCGGAACAG CTCGTCCAACGTGTCATCAT 436 FY226350
CLFL003_I23.f gSNP03665 AATGTCAACTGCATGACCGA AGGGATCCAGGAAGACCTGT 491 FY226442
CLFL003_J15.f gSNP03667 TGTGTGTGTGTTTTGCATGG GAGCCCAATATCAGCAGGAA 463 FY226458
CLFL003_K22.f gSNP03671 TTGTGGGTGCCTCTCTTTCT TTATGCCCACGTCAACTGAA 476 FY226489
CLFL003_L06.f gSNP03673 TTGATGGATTTGTGAGCCAA TGAGGGAAGTAGAACACCCG 451 FY226497
CLFL003_M08.f gSNP03677 CCAGTAATTCCAGTGCGGAT TATCGTAACACCTTTCCGGC 452 FY226523
CLFL003_P17.f gSNP03686 GGGAAAGAAGGGGAAGAGTG GTCATGGGCTCCCCTAAAAC 449 FY226603
CLFL004_E06.f gSNP03701 GAAACCACACGCAATCACAC CAACTCTGCTGCCGTTATCA 438 FY226710
CLFL004_E15.f gSNP03702 TCCCTTTTAACAAATGGACCC CCATTTCTGTAGGGCAGGAC 474 FY226719
CLFL004_G24.f gSNP03708 GCGTATCAGGGTTGGTCTGT CCAAAACTCCCACTTCCAAA 417 FY226774
CLFL004_H17.f gSNP03714 GCCATTCCACGATATTGTACG TAAAGGGCAATGGTCAGGAG 439 FY226789
CLFL004_H21.f gSNP03715 TGTGCAGGTGTGAGACATCA TCTCGGCCTCCAGTTTCTAA 420 FY226792
CLFL004_I02.f gSNP03717 CGGATACTGTAGAAAGCCCG AACAAAAGAGCAGGGCTGAA 456 FY226797
CLFL004_I07.f gSNP03718 TGGGATGACAGGGAAGAAAG TGCAACCACAACATTTGACC 527 FY226802
CLFL004_J12.f gSNP03723 GGTCCAAAAACCAGACAGGA ACATCATCTCCACCCTCAGC 458 FY226831
CLFL004_J14.f gSNP03724 CCCCATCTTCTCCCTTCTTC AATGGCTGGGTAGAAAACCC 423 FY226833
CLFL004_J22.f gSNP03726 ATGGACTTGTGTCCCCACAG ATTGCAGGCTGATCAAATCC 449 FY226840
CLFL004_K15.f gSNP03728 AATCGGGGTTGTCTGTGAAC TGTCACCCAACAGAAATCCA 439 FY226856
CLFL004_L15.f gSNP03729 TTTGACATCCATCTTTGGCA TTGCTGAATCTCCCCTTTTG 466 FY226880
CLFL004_L20.f gSNP03730 AAAAACGAGGACGGGAAAGT CCGGACGATTTTTGATGAGT 420 FY226884
CLFL004_M11.f gSNP03732 GCCATGATTGTTGTGATGGA TGCAGCTCTGCAACTTTTGA 475 FY226899
CLFL004_N08.f gSNP03734 TCTCTCGAAGAAATCCCGAA AAAAATATGCCGGCTCTGAA 440 FY226920
CLFL004_N24.f gSNP03736 GTTTGGTTTGGAGGAGAGCA AAGTGTTTTAATGATTTTGGCGA 472 FY226936
CLFL004_O10.f gSNP03737 CGAATTCTCCTCTCGTGTCC GTTCCAGTCTGTGTGCCAAA 454 FY226946
CLFL005_A06.f gSNP03740 TCCCTAAAGCCACCTCATTG CTCCACTTGGAAATAGCCGA 428 FY226987
CLFL005_B02.f gSNP03744 CCCTGGTCTTGATTCCTTGA CACCACGCACACCATTACTC 453 FY227004
CLFL005_B14.f gSNP03748 GTGCTTCTTCCAGCCTTGAC ATGCTTGGGAGGAGATGATG 425 FY227016
CLFL005_B22.f gSNP03749 GCTACAGAGCTTGAATGCCC CTCCCACCTCCAAAGCTACA 464 FY227024
CLFL005_B23.f gSNP03750 CATCCGGCGTTGTTTACTTT AAGGTCTGTAGAGCCTTGCG 422 FY227025
CLFL005_D16.f gSNP03754 TGGCCAATTCCTCATCACTT TGCCCTTTTCCTTATGCTTG 453 FY227063
CLFL005_E18.f gSNP03756 CTTGGATGTTCCTCGGATGT TCCACCCTGTAGGAGAGGAG 457 FY227085
CLFL005_F01.f gSNP03759 GCAAGAAGATAATCCGTGGG TGCAGCGCTCAAAATATCAC 427 FY227091
CLFL005_F08.f gSNP03761 TGACACTCCTGCACCAGACT TCTCTGTCACGCTTGAGTGG 455 FY227097
CLFL005_F09.f gSNP03762 CCTCGAAAAGCACTGTGGAT TTGCTTCCTGCCAGAAACTT 473 FY227098
CLFL005_G22.f gSNP03768 GGAGGAGCAGTTAGGCTTCA AAAATGTTGCACAGCTGCCT 502 FY227129
CLFL005_H18.f gSNP03769 TTTCATCCGATCAACGTGAA AGATTGGCGTAGATGGCAAC 462 FY227148
CLFL005_J03.f gSNP03773 CCATTCTCGCTGTGCTGTAA GGCCTTGATCTCGGATGTTA 496 FY227175
CLFL005_J07.f gSNP03775 ATGAAATCCATGAAACCCGA GGAATCAAATTGTTCTCCGC 429 FY227179
CLFL005_J21.f gSNP03777 CTGGTTTTGCATTCAGAGCA CTTTCACCAACTTGTGGGAT 500 FY227193
CLFL005_K12.f gSNP03779 CACCCTTCTCAAATCTACCGA CCAGAAAGCCAAACCACAAT 507 FY227207
CLFL005_L12.f gSNP03782 GGGGGCTATCCTTATGCAAT GGAATGAAGCCACTGGTGTT 477 FY227228
CLFL005_M18.f gSNP03788 TCTTAAAAAGCGAGCAGGGA GGCTAAGGGTTTGAAAGCTG 465 FY227254
CLFL005_M22.f gSNP03789 TCCATCAAGCATTCAATCCA AGCCAATACAGGGGAGCTAA 417 FY227257
CLFL005_N20.f gSNP03791 GGCTTTGGATTTGTGGAAAA TCACTGCATAAACCCTGCAA 490 FY227279
CLFL005_P08.f gSNP03797 AAGGAGGGAACAGAAGCCAT GCTTCGGCATACAGGAAGAG 432 FY227312
CLFL005_P24.f gSNP03799 TTGAATTTTTGAAGCCCACC AGAAGAATTGCCACCCACAA 429 FY227326
CLFL006_A01.f gSNP03800 AGGCAACCATGTTATCCCTG GCTCCTTCAGATCATCCAGC 491 FY227327
CLFL006_B01.f gSNP03804 AACATGACATTGGAAGGATCG AAACACAGCTGTTGAATGTCG 466 FY227351
CLFL006_B06.f gSNP03805 ACCACAATTCCCATCACCAT GGCACACCCAAAGTCTGAAT 423 FY227356
CLFL006_B17.f gSNP03808 TGCTAATGCTAATGAATGAATCG TGGCGATATGGCATAACAGA 438 FY227366
CLFL006_C03.f gSNP03810 CGTGAACAAGGATTGATTGG TGGGGTCACAGGAACTCTTT 430 FY227376
CLFL006_C14.f gSNP03812 ATCCAGAGCAAGGCAAAGAA CTTGAGGTCAGCTGTGTCCA 420 FY227387
CLFL006_C18.f gSNP03813 AAATCGGCGTTTCATTTCAC AGAAGTGGGATCTGGCACAC 451 FY227391
CLFL006_D06.f gSNP03816 TCTCCTCACACGATGACAGC ATGAGGGCAGCAATTCATTC 475 FY227403
CLFL006_D11.f gSNP03818 TGCTTCAATGTGGCTGTGAT AGGCTGCACAAAAACCAAAC 430 FY227408
CLFL006_E06.f gSNP03819 TTTACAGGAACCCCAATTTGA TTGAAATCCGTAGAATGCCC 454 FY227426
CLFL006_F03.f gSNP03825 CCCGCTACTTACCCAATCAA TGCGGCATGTATAGCAGTTC 444 FY227447
CLFL006_F04.f gSNP03826 ACAGTCCCAGGGCATGATAA AATCTTGGGCACCATTTCTG 424 FY227448
CLFL006_G08.f gSNP03832 GCTTTGCGTGGATCAATCTT AGCTGGATGGTCATACCCAC 497 FY227476
CLFL006_H02.f gSNP03834 TTCCCAATCCTTGCTTTCTG CCTTGCTGGAAAAACAGAGC 471 FY227494
CLFL006_I05.f gSNP03841 CAGTTTAATTCGGCACAGCA GTCCAACGAAAATGCCAAGT 452 FY227521
CLFL006_I12.f gSNP03842 AACTCGAGTGTTGGATTCGG TCAACAGATCCTCCCACCTC 457 FY227528
CLFL006_J04.f gSNP03843 CTCGATGGATGATGCTGAGA GTGGGGTGGAGAAGAGATCA 431 FY227544
CLFL006_J13.f gSNP03844 TTCTAGGCGTATGGAGTGGG CCAATATCATCCAACGTCCG 419 FY227553
CLFL006_J18.f gSNP03845 CCTTCACATTTCATTCGCCT CAGATGCAGAAAATCCCCAC 459 FY227558
CLFL006_L05.f gSNP03848 CGAACACGCAAGAAGATCAA ACGCTTGGTGTCATCATCAG 442 FY227592
CLFL006_L14.f gSNP03849 GCAAGCTTGAATGAGTTCTTTG GCAAGAAAGGACATTTTGTATGC 506 FY227601
CLFL006_L18.f gSNP03850 TCCGAAATTTGCAGTGGAAC TCCTCCATCCTTGAGCTTGT 447 FY227605
CLFL006_M20.f gSNP03853 GTAGCGAAACCTTGACTCGC TGTAATGCTGAAACGCCAAG 468 FY227631
CLFL006_M23.f gSNP03854 ATGTCTGAATCTGCCCATCC CCTCTGGGTCTCCTTCCATT 475 FY227634
CLFL006_O19.f gSNP03858 TGGTGTACCTGGTTTAGGGG ACTGCCGCTACAATTCTCGT 459 FY227677
CLFL006_P01.f gSNP03859 ACATCCTCCGCAATTTTCAG TGAGGGGCATATAAGTGCAA 433 FY227682
CLFL006_P12.f gSNP03861 GCAATGGCAATCTCAGGAAT AACGGATCACCAGAAACCAC 440 FY227693
CLFL006_P23.f gSNP03864 CGGAGAGGAGATGGACAAAG CCGTCTTCATTTAGAGGGCA 420 FY227704
CLFL007_A03.f gSNP03865 ACAGCGAAGATTAGAGGGCA TGTGTACGCGTAAGGAGCAG 466 FY227708
CLFL007_A09.f gSNP03866 AGAGCACAGCCTGCAAAAAT TTCTTTCAACAATCGGAGGG 480 FY227714
CLFL007_B01.f gSNP03872 GCAATCATCCCAATCACTCTC CCATCCATGGTGTCAGATCA 440 FY227730
CLFL007_C22.f gSNP03880 ATGTGTCCAAGTGGAGGAGG AAAGGCGTTGACAACCAAAT 448 FY227775
CLFL007_E10.f gSNP03887 TCCAGCATGCATTTCTTTCA TAATGACAGGCTCCCACACA 429 FY227811
CLFL007_F01.f gSNP03888 ATTCAAGGGAGAGAATGGCA CTTCCCCAAAACCCACCTAT 470 FY227826
CLFL007_F16.f gSNP03891 TAATGGTGATGCATTGTGCC TCTCCTCGGCCTCTTCTACA 447 FY227840
CLFL007_G05.f gSNP03893 AGTCAGCATGGCGTTCTCTT ACCCTGTCAACAAAGGCGTA 440 FY227853
CLFL007_H14.f gSNP03900 ATAGTGCTTGCCGTTCTGGT TATGAAAATCCAACCCCAGC 503 FY227886
CLFL007_H19.f gSNP03902 AGGGCTCTAGGCACAAAACA TTGCAATCAACCCTTACATCC 447 FY227891
CLFL007_H23.f gSNP03903 GTTTGCACAACTGCTCTTGC TGCCGTATCCAGGTACGATT 433 FY227895
CLFL007_I15.f gSNP03907 GTGGGTTTTTCTCACCCTCA GAGGAACAAAGATTGCAACAAA 457 FY227911
CLFL007_I19.f gSNP03908 CTGCACTCCAGGCCATCTAC GGATCCGCCGTAGTTATGAA 478 FY227915
CLFL007_J08.f gSNP03910 TTTCGGCAAAATCCTCAATC AGATAATCTGTGGCCCATCG 461 FY227926
CLFL007_J09.f gSNP03911 TCTGTTTTAGGATTTCTGGATGA AATTCCATCACAATCCCCAG 501 FY227927
CLFL007_J17.f gSNP03914 TGCATATCATTGCGTGACCT TGACTCTCGATGCCCTTTTT 462 FY227935
CLFL007_K22.f gSNP03917 GCTCTGCATTTTCCCACTGT GATACCCTCGACGCTAACCA 418 FY227964
CLFL007_L09.f gSNP03920 GGAGCAAGAGTTTTCACGCT ATGCTGTGGCCGATATTTCT 449 FY227975
CLFL007_M03.f gSNP03923 CGGGCATGGAGAAAGAAATA GCTTACAATTGGGCAGAAGC 498 FY227991
CLFL007_N07.f gSNP03929 CTGGGTTTCTGCAATTTGGT AATTATGATTTGTTCTCGTCCTG 481 FY228019
CLFL007_N09.f gSNP03930 ATCAAAATGTCCGGCAAAAA GAGTTTCTTCGCCTAGGGCT 444 FY228021
CLFL007_N11.f gSNP03931 TTGTTTGAGTTGCATTTGGC AAACCCTAGCAAATTGCGG 461 FY228023
CLFL007_N14.f gSNP03932 ATTGTTTGGTGCGAAATGTG CCAATAAGCGGGTCAATCAC 416 FY228026
CLFL007_N19.f gSNP03933 CCTGCTATGACTCATTCCACAA CAACGACCAGATGAAGAGCA 505 FY228031
CLFL007_O02.f gSNP03934 GGGAGAATCCCTTTCTGGAC TGCACCCTTATTCGAACCTC 491 FY228038
CLFL007_O05.f gSNP03935 ACACCCTCAGAAGATTTGCG CTCAGGGGTGGAAGTGTCAT 330 FY228041
CLFL007_O17.f gSNP03937 TCTCACATTTCATTGGGAACC CAAATTTCCCGAAAGATGGA 422 FY228053
CLFL007_O21.f gSNP03939 CATCAACCCAATGGAGAGGT TAGTCGAGTGGTCGATTCCC 481 FY228057
CLFL007_O23.f gSNP03940 AAAGGAAGCATATGGATGCG TTTTTGGTTGCAAAGGTTCC 440 FY228059
CLFL007_P21.f gSNP03945 TCGCCATTAAAATCCGTCTT CAGACATCCCACATCATTGC 425 FY228081
CLFL008_A03.f gSNP03946 AGAAGAAGCCACTTTTGGCA CTCCGTTTTGATAAGGGATCA 464 FY228087
CLFL008_B15.f gSNP03950 GTGCATTATTTTGCGGGTTT CCATTTTGGACAAATGGGAC 420 FY228123
CLFL008_C12.f gSNP03953 TTTTATGTGGGTGCATCGAA CATCCAGCAACCGACTCTTT 452 FY228144
CLFL008_C22.f gSNP03956 AAATTTTGGCTTTGCTGGGT AGCTCCAGTCTTCCCAATCA 443 FY228154
CLFL008_F10.f gSNP03964 GACTGGAAAAAGTGGCCTTG CAACACATTTCTCCCAAGCA 455 FY228213
CLFL008_G12.f gSNP03965 TGGAATGCCCAAAGAAGTTT ATCCTGGCATTTATGAACCG 434 FY228239
CLFL008_G16.f gSNP03966 TTTTGCTGTCAACCCATTCA GAAGCTGCCATGGCTCTAAC 474 FY228243
CLFL008_H15.f gSNP03968 CCCAAAACCCACTACTTGGA CCACTTGCAACAGCAGAACA 462 FY228264
CLFL008_H18.f gSNP03971 CTCGCTTATTGCAGACTCCC CGTGATTGTCGTTGATGTCC 428 FY228267
CLFL008_H24.f gSNP03973 TCCTAAACAAAACAAACGAGCA GATCTGGGAACGAACACCAC 429 FY228273
CLFL008_I04.f gSNP03974 TATCCAAGCCCATGGAGAAG TGAGTTGAACCATAATCAAATCAGA 450 FY228277
CLFL008_I09.f gSNP03975 GTGGTGTAGCATTGCCAGAA GACTCTCCACTCTCCTCCCC 416 FY228282
CLFL008_I12.f gSNP03976 CAGTCCACAGAAGCAAACCA AATGCATTCCAGGGCACTT 448 FY228285
CLFL008_K22.f gSNP03987 AGACCACCAGAGACTGTCCG CAAAGCCCACTTGGGTACAT 430 FY228340
CLFL008_M05.f gSNP03992 GGTCGTGACAGTGGGCTTAT TGCTTCCTGGACACAGTTTG 495 FY228368
CLFL008_M18.f gSNP03994 GGAGTGGTTTGCTGATTCGT TAGCCACCATGATGTCCTCC 455 FY228379
CLFL008_N01.f gSNP03995 TGGCTGGTGATCCAATAACA AGTTTCGACTGGGCTTTCAA 452 FY228386
CLFL008_N02.f gSNP03996 CCGCCTGTCTAAAATGGAAC GAGGGCATTTCCAAAGACAA 492 FY228387
CLFL008_N19.f gSNP03999 AAAATGAGCTATGGCCTCCC TCTCTGGAATTACGCCATCC 472 FY228404
CLFL008_O24.f gSNP04004 AGGATTGGCTGGCTTCTACA TTGGGTTTGGATAACTTCAAAGA 531 FY228430
CLFL008_P12.f gSNP04006 GGGTACATCCGCAAATCAGT CACCTGAGCCCTAATCTCCA 431 FY228440
CLFL009_B04.f gSNP04008 CCATTGCTTAAATGGGTGCT CTTGGGACTGTTAACGGCTT 420 FY228472
CLFL009_C05.f gSNP04013 TTACGTTGTTACCCCGATCC TCTTTGTCAGCCTGGTCAAGT 458 FY228489
CLFL009_C06.f gSNP04014 TTCCAAGCCTTCTGACCAAT CATTTTGAACCCCAAATGCT 508 FY228490
CLFL009_C18.f gSNP04017 TAAGGTCTCAGGCAAAGGCT ATACAACGGTGCCTTGCTTC 482 FY228501
CLFL009_E05.f gSNP04018 TCCGAGTCGTATTCCTGGAG CCTGTAGAACTTTCGGCCAG 440 FY228526
CLFL009_G12.f gSNP04023 TCCCGTTTCCATTCCATTTA CAACTTATCCAAATCGCCGT 508 FY228567
CLFL009_G16.f gSNP04024 GAGCTGATTCAGACGCTGTG TGATGGGTTTTGGGATCAAT 455 FY228570
CLFL009_H11.f gSNP04027 TGGAGGCTCTGGAGATGGTA CAAAGGGTGAAGATCGTCGT 431 FY228584
CLFL009_I01.f gSNP04028 TGCGTAAAATGGAGGAGACC TGTATCCGACCTTCCCAGAG 428 FY228592
CLFL009_I05.f gSNP04029 GAGTCTTGGGAGCCATTCAA TGCTGCAAAATGAAGAGCTG 431 FY228596
CLFL009_I06.f gSNP04030 GGAGTGCCTCGAGTTTTGAC ACCAGTGAGGCTTTCTTCCA 478 FY228597
CLFL009_I08.f gSNP04031 CTCCTTGCTGGAAGAGATGC GCATCCACTGTAGCAAACCA 422 FY228599
CLFL009_N05.f gSNP04040 GATAGTCCGTGACGAGGGAA GCGCAGAAAATCTAGCAACC 420 FY228683
CLFL009_P06.f gSNP04042 CGAATCGTTCAAACTGCCTT CAGACTGAATCAAAGTTTCCCC 417 FY228714
CLFL010_B10.f gSNP04046 ATTAACGGCCAGGATGATGA TTTGCCATATCTGCCTCCTC 441 FY228755
CLFL010_C11.f gSNP04048 TTGTTCAGTTTCTGGAAGCG CCAGTGCAGTGAAAAGCAAA 446 FY228780
CLFL010_D24.f gSNP04053 CGGACGAGTCGTTTCTTTTC AGTGGGAAAACCCCAACTCT 452 FY228817
CLFL010_E02.f gSNP04054 GGACATTTTGTATGTGAAGCCA CATTGCCAAATCTGATCGTG 426 FY228819
CLFL010_E11.f gSNP04056 ATGGCTTTGATGGTCCTCTG CAAATTCCTCGGTTAGTTCCA 457 FY228828
CLFL010_F13.f gSNP04061 GGGGAGAACCCATTTTCATT AAAACAGGCATTGAACAGGC 427 FY228853
CLFL010_F14.f gSNP04062 AAAAACATGCCAATTTCCCA CAATACCCAGTCCCTGCAAT 444 FY228854
CLFL010_G03.f gSNP04063 GCTTCCTTTGCAAAAAGCAC TGGAACCACCACAGATGGAT 481 FY228867
CLFL010_H05.f gSNP04066 TTGCCATTTGCCAATCAGTA GTTGGCTTTCGCTCTTTGAC 425 FY228892
CLFL010_H14.f gSNP04067 GCTGCTCGTTTCATGATGTT GCCTTGAAGCAAAAATACGG 444 FY228901
CLFL010_I13.f gSNP04069 ACCCATCGGTTCTTTGATTG CCTGTGAAGACAGGAAAGGC 417 FY228924
CLFL010_J20.f gSNP04073 TGCAGCCATTGTTTTCTCAG TATGCCATGCACCATTTTTG 422 FY228954
CLFL010_K19.f gSNP04076 TCAGTTTGCTGCGTCAATTC CACCCATAATTCTGACGGCT 488 FY228977
CLFL010_L06.f gSNP04079 TCCAAAGCAAGGCAGTTAGG ACTGGGCAGTTCCAAGTCAT 446 FY228988
CLFL010_L22.f gSNP04081 CCCGGGTTCTATCTTTTTGA GTGCCATTGTTGCACTTCAC 416 FY229004
CLFL010_M05.f gSNP04082 CTCTGAAAGGGAAAACTGCG TTAGATGCGCTTGACAGCAC 436 FY229011
CLFL010_M11.f gSNP04084 CCGAGATTGTTTTCAATCCA TTTGCCAAATGTAGCTGCTC 446 FY229017
CLFL010_M14.f gSNP04085 TTTAGAAACTTGCAAGAAACCC TGGAATGGTAAAGTCCCTGG 443 FY229020
CLFL010_P08.f gSNP04093 TTTGAGGCACTGACATGAGG TTGCCAGTGACTCTGACTGC 423 FY229085
CLFL011_A06.f gSNP04098 GGTGCATGTTTGGACCACAT TGACAAGAGCGTGACTCCAC 485 FY229106
CLFL011_A11.f gSNP04099 GAACGAGGAGGAGACTCGTG CAGCCAAACGGAAGTTCAAT 465 FY229111
CLFL011_C04.f gSNP04102 CCTCGTTGCTTCTAGGGACT TGCATGAGAATCAGCTCCTG 472 FY229152
CLFL011_C14.f gSNP04104 TGCACTGAATCCTGCTTAGG CAACTGAAAAATTGGGGCAT 454 FY229162
CLFL011_D01.f gSNP04105 GAAACTCGTGGAGGAGTGGA CTCGTGCAAGCAGACACAAT 420 FY229173
CLFL011_D24.f gSNP04110 AGAGAGCCCCAGGATTTCAT GCAGGGGTTGAGAGACAGAG 515 FY229195
CLFL011_E06.f gSNP04111 GTGGAGTGGCAGACAGGAGT GCAATTCCATCAAACCCAAT 436 FY229201
CLFL011_E14.f gSNP04114 AACTGTTATGGTGCATGGAGAG CTCTGCAATATCGGCATTGAT 318 FY229209
CLFL011_F08.f gSNP04117 GGGGCAGAAGCAATATGAGA TTCCTGTTGCAATTCGATGA 444 FY229227
CLFL011_F17.f gSNP04119 TGTTATGCATTGCCCTCTTG TTGCAGTCGTGAGGAACATC 483 FY229236
CLFL011_F21.f gSNP04121 GCAGATCCTGATCCTCTTGC ACTTCAATATGGCCTCGCTG 445 FY229240
CLFL011_I20.f gSNP04126 GCTAGGGGAAACTCTGGGTC GAACTTTCATGGTGGCAGGT 444 FY229311
CLFL011_I21.f gSNP04127 TTCGGCTTCTTCGTCTTTGT ATGAGCCGAGCTACCACATT 433 FY229312
CLFL011_I24.f gSNP04128 GGGTTTGGAGGATTTTGGAT CGGTCACATATTCTACTTCTGGC 443 FY229315
CLFL011_M10.f gSNP04132 TTGGTTTACCCCAAGAGCAG AACCCTATCTTCCACAGGCA 443 FY229396
CLFL011_M14.f gSNP04134 CCACTGCTGGGAGAGACATT TGACTGGCCATCAGATTGAA 434 FY229400
CLFL011_M18.f gSNP04135 CGAGCATTCTTGTTTGTTTGA AACATAAATGCCAACTCCGC 451 FY229404
CLFL011_O07.f gSNP04138 TAAATTGCGAAAATGCCACA AATTCGCGAGCAGTGAGATT 466 FY229441
CLFL011_O24.f gSNP04143 AGAGCCACGACACTGGAAAT TTGACGCCGAATTCATAACA 435 FY229458
CLFL011_P02.f gSNP04144 CAAATGGCAGCTTCCAAAAT GGGACATTCACAGAAGGAAAA 480 FY229460
CLFL011_P03.f gSNP04145 AGTACAATTTCTGCGCGATG AGAGATTGCAACCAGGAACC 417 FY229461
CLFL011_P07.f gSNP04147 AAGAATAGCCCAATTGCAGG CATAGCCCATTCCCACAAGT 440 FY229465
CLFL011_P20.f gSNP04149 ATAAGCGTCTTGCCTGCACT CCATATTGGGCAGGAGAATG 458 FY229478
CLFL012_B03.f gSNP04153 AGCATTCATGCTCTGCAATCT GCTGTGTCATCCACCACAAC 425 FY229507
CLFL012_B07.f gSNP04154 GGGTAACTTCATAGCAGGGGA CAAATTTGGCGTAGAGGGAA 423 FY229511
CLFL012_B13.f gSNP04155 GTGGGGAACCTCAGTTCAGA TGTTGAATGACAATGCAACCT 482 FY229517
CLFL012_B14.f gSNP04156 TGCATTCTCCTCCCATTTCT TCCAAAGCTTTCATCTTGGC 438 FY229518
CLFL012_B23.f gSNP04159 AGGTCTCAAGATCGATCCCA GGAAGATTGGTGTGGGCTAA 447 FY229527
CLFL012_C08.f gSNP04160 ATCTAAACTGCGGCCATGAG GAGAGTGTTTCGTGTGGGGT 454 FY229536
CLFL012_D07.f gSNP04163 CATTGTGGGTACTGCATTCG CCTTTGCATCTTTCTCAGGC 417 FY229557
CLFL012_D24.f gSNP04165 AGCTCCAATCACAACCCTGA AAGGAAGGGGGTTTTCTTGA 466 FY229574
CLFL012_E10.f gSNP04166 TGCAATGCTTCATTGGTCTT CTATCCAACAACCACAGCCC 431 FY229584
CLFL012_E13.f gSNP04168 CCTGTAACATGGCGACCTCT CTTCTTAGTGGCCGGATTGA 449 FY229587
CLFL012_F20.f gSNP04174 TCATTTGGGCTTCACTTGTTC TTCCCAATCCAAGTCCAATC 477 FY229618
CLFL012_G03.f gSNP04176 ATGCAAATGTCGCATTTCTG TCCATGTCTCAGCCCTCTTT 417 FY229625
CLFL012_G04.f gSNP04177 GATCAACCAATCCATTTCGG CCTGCTTTCGTCTTTCATCC 430 FY229626
CLFL012_G23.f gSNP04180 GGAAATATTTTGGCTGAGCG TTCCGACCAGTTTCTTGAGC 434 FY229645
CLFL012_I13.f gSNP04184 TCAGAAGGATCAGGGACACC CCAATCTCTTTTCTCTGCCC 425 FY229682
CLFL012_K06.f gSNP04189 GCTCAACCCAAAACCCTACA TTCGTCTTCATCCTTTTCCG 491 FY229722
CLFL012_K17.f gSNP04192 TCTCCCAGCTCCACAAAAAC GAATGCAGGCCTCTATGGAA 509 FY229733
CLFL012_K22.f gSNP04193 TGGAGAAAACTGGAAGTGGG GGAGTGGTCGAAAGTGGAAG 418 FY229738
CLFL013_B20.f gSNP04215 TGGATGCTATCAAATGGGGT AACTGAATTCCGTCATTGCC 486 FY229887
CLFL013_C10.f gSNP04216 ATGAGGGCACGTTGTCTTCT TAACGAGTCTCTCCTCCCGA 447 FY229898
CLFL013_E06.f gSNP04222 GCTGAGAAACAGCCATGTGA GCAGAGCATCCAGAATCTCC 437 FY229938
CLFL013_J02.f gSNP04228 AGTATCGCGGAATGAAATGG TTTGCAGCCACAGCTTATTG 428 FY230026
CLFL013_J11.f gSNP04230 TGCGTCTTTCATCATTGCTC TGGCTACAAATCACCACACAA 475 FY230034
CLFL013_K08.f gSNP04232 TAAATGGTTCCGGAAATGGA TCCATATAAAAACCCGCTGC 457 FY230052
CLFL013_L14.f gSNP04234 TAACAAGCACAGCGAAAACG TGCATCGCAGAAATTCAAGA 456 FY230070
CLFL013_M24.f gSNP04235 GGTCCAAGTCTGGGGTTTTT TTGGCCCACAGTACAATGAA 464 FY230088
CLFL014_A16.f gSNP04244 TGGGTGGGAAGAAAAGTGAG GCAATTCCTCTATTGCTGGG 442 FY230157
CLFL014_A17.f gSNP04245 TTTCCGAAAAGTTGGACCTG TAGGAATGCGTATGGCACTG 452 FY230158
CLFL014_B09.f gSNP04246 TTTGGGAGGATCACAAGAGG CACCCTTGAGAAAAGGACCA 447 FY230173
CLFL014_B10.f gSNP04247 GGATCAACCAAAAATGTGGAG AGTAGGAAAGGCGCAATCAA 460 FY230174
CLFL014_B14.f gSNP04249 TTGCAGAGCTATATGCCATTTT AATCAAGGCCGACTGCTTTA 438 FY230178
CLFL014_B23.f gSNP04250 TGTGCTGTGCTGTTTCCTGT GTATTGTCAGGCAAAGGGGA 478 FY230187
CLFL014_C01.f gSNP04251 TTAGTCAGCAACAAGTGCGG AAGCAGTCGAGCCACCTAAA 494 FY230189
CLFL014_C04.f gSNP04252 CGGTCGCACCTTATCAATTT AATGTACTCACCCTCGTGGC 468 FY230192
CLFL014_C12.f gSNP04254 GCCCTCAAAGAGAAGCAGAA GCTTGCCTTTCAGGAGATGA 426 FY230200
CLFL014_D15.f gSNP04259 TTCGGTATCTGTCTGGTTGTG CCAGGAATCCAGTGTGCTTT 526 FY230227
CLFL014_D21.f gSNP04261 CTGGATGGAAAACTGGCCTA TAGGGCTCCCTTCAAATCCT 443 FY230233
CLFL014_E04.f gSNP04263 AATGCCTTCAACAGGAGTGG GCCTTTCTTGGTGGGTATCA 421 FY230240
CLFL014_E24.f gSNP04266 TTCAGCATTACCCGAAGAGG CCTCGCTTTCCAAACAACAT 494 FY230260
CLFL014_F12.f gSNP04268 GTGACCTTCCGAGCTTTCTG AAACAGGGGCAACAACACTC 519 FY230271
CLFL014_F20.f gSNP04270 GTTGGGGCCAAAATCCTACT GCTGTGTCTTAATGCCACCC 479 FY230279
CLFL014_H08.f gSNP04275 CCTGTCCGGAACATAAATGC GTTGACGGTGGCCTCACTAT 403 FY230314
CLFL014_H10.f gSNP04276 TAGGTCCACATTTTCCTGCG TATCCATGAACGCGTTTGAA 425 FY230316
CLFL014_H20.f gSNP04278 CCCCTGGTTTATGAGGAACA GAAGGGCAGACAAAACGGTA 447 FY230326
CLFL014_I03.f gSNP04280 TGGATGCATGTTTCTCCAAA CCATATTGTATTCCAGGTGCG 451 FY230333
CLFL014_L20.f gSNP04288 CAAACATGTGCACAGAACCC CAGGAAAATGAGGCAATTCG 421 FY230421
CLFL014_N22.f gSNP04296 AATCTGCGAGGGTGAAGATTT CGCTTAGTGCCACCAGTACA 435 FY230471
CLFL014_O17.f gSNP04297 CTGGCAAGGATTCGGTTTTA GGGTCTGCCGAAAAATACCT 476 FY230488
CLFL014_O21.f gSNP04299 TTTGTCCGATCTCGTCAATG AAACATACCGTCAAACCCCA 419 FY230492
CLFL014_O24.f gSNP04300 TGCAGAAACGTTATTTCCGA AATGTTGAGCTTAATGCGGC 445 FY230495
CLFL014_P01.f gSNP04301 GCACCCAAGTTCACCATTTT ACAGTCATAGCTGCGTGTGC 441 FY230496
CLFL014_P03.f gSNP04302 GGTTTCATTTTCCTGGATCG ACAATCTGTGGAATGCATGA 421 FY230497
CLFL015_B06.f gSNP04308 CAGGTCAAAAATCGATTGGC TCGTGAAAATCCATCCCTCT 452 FY230547
CLFL015_B19.f gSNP04311 TCCGAGGACCAGAGAACATT TGCTCACTTCGTACACTGCC 478 FY230560
CLFL015_D21.f gSNP04318 CGATTCGACACTTAGGGGAA CCAGCGGTTTCTAGCTTCAG 455 FY230604
CLFL015_J18.f gSNP04345 AAGGAGATAGGACACGGGCT GCTGCAGAAACAGCTTTGAA 421 FY230734
CLFL016_F22.f gSNP04391 GAAGAATAAGGGAAGCATGGC GCAATTTTGCACCCTTGAAT 425 FY231006
CLFL016_G01.f gSNP04392 CACCTCCTGGTATGGCATTT CCAACCGCTCGAGTAAAGAG 485 FY231009
CLFL016_G03.f gSNP04393 TTGGATCAGAAGGTTGAGGG CATTAATGGCCTGTTGCTCC 428 FY231011
CLFL016_I02.f gSNP04398 TTGCCGAAGAAATTCAAAGG TGGGCAAGCTTTCCTCTTTA 423 FY231057
CLFL016_K07.f gSNP04410 AGAGCCTCGAGATTTGAGCA AACCTTAGGCTTTCCCATGAA 415 FY231109
CLFL016_L03.f gSNP04411 TGAGTGGAGCTCGTTGAAGA CCAGATTCACCCACCTCTGT 439 FY231126
CLFL016_L07.f gSNP04413 TCAAGGACAATGATGGCAAA TACAGGCACCCACAGAATGA 503 FY231130
CLFL016_L11.f gSNP04414 TGCTTGCATTCCAACTCTTG GGTTCTCATGGATCTGGGTG 431 FY231134
CLFL016_L18.f gSNP04417 CCACCTAGACTGAATCTCTCCC CCCCAAAGCGGCTATATTTT 431 FY231141
CLFL016_M02.f gSNP04419 AAATCTGAAAGGCAAAGGCA CTGGCACCTGCTCAAATGAT 417 FY231149
CLFL016_M23.f gSNP04421 GCTCTCAAGCTGGTTGACCT ATATTCCCGACATGCCTCAG 446 FY231168
CLFL016_N03.f gSNP04422 GGACTGTTCTGGAGCCTGAG CGAAATGGAGTTCCTCCAAA 470 FY231172
CLFL016_N12.f gSNP04423 TTCGCTGTCAAGAGACTGGA AGCTTCAAACTGCTCTGCAA 417 FY231181
CLFL016_O15.f gSNP04426 AAGCAAGTATCAGGGCGCTA AAGAGAGGGTTCTTTGCATCA 420 FY231208
CLFL016_O20.f gSNP04427 CATCTCTAACAATGGCGGGT TCCACGTGTCGAAAGTTCAG 428 FY231213
CLFL016_P10.f gSNP04431 CAGTTCGTTTTGGAGGCTGT CTCCCAATCACCTGTTTCGT 435 FY231227
CLFL016_P13.f gSNP04432 AATCAGCTGCCTCCGATAGA ACAAAAGTGCCTCGTCATCC 421 FY231230
CLFL016_P17.f gSNP04433 CGAAGAAGTTTGATCCAGCC CAAGCTCTGGCCTTGAAGAT 416 FY231234
CLFL017_B15.f gSNP04439 TGAAATGGTGCAGTTCCTCA ATTTGAATCGCCTAAGCTGC 442 FY231279
CLFL017_C21.f gSNP04444 AGGAACTCCTTCTGCTCGGT GGAAAGAAGCCAAATGGTCA 423 FY231308
CLFL017_D02.f gSNP04445 CGAATCGTGGGAATTTCAGT GTATTTTAACCACGCTCGGC 440 FY231313
CLFL017_E17.f gSNP04448 TGGGAGAGTAAGTGCGGTCT ATTGGAAGATGCCATTCCTG 414 FY231352
CLFL017_E19.f gSNP04449 GAATGCTCTTTCGCTTCCTG CCCAGCTGAATCTCCTTCTG 424 FY231354
CLFL017_G07.f gSNP04451 TTTTCCAGCTACCAGGCATT CCATTGCTGGCATAACCTCT 460 FY231390
CLFL017_I05.f gSNP04456 ATCGCGCTTTGGCTTTTAC TCGGACTCTGTCTTTCAAACTTC 422 FY231434
CLFL017_J21.f gSNP04461 TGGCAGAGTCCAAGGATTTC GAAACAGGGGGTTTCTCTCC 461 FY231474
CLFL017_L01.f gSNP04464 GATCAAACATCGGAAGCCAT CTTTTCGCGGCTTAATTGAC 439 FY231502
CLFL017_N21.f gSNP04470 TGCTTGAACTCTTTTGCGTG AGTTATGTCGTTGGCAAGGG 445 FY231569
CLFL017_N24.f gSNP04471 GTTGAAGGGCTTGCTTTTGA AATGCAGAAACAACACCACG 424 FY231572
CLFL017_O07.f gSNP04473 TCACCTACAAGCGCTGAAAA CCCCTCAGGACTTGCTGTAA 420 FY231579
CLFL018_A20.f gSNP04479 GCAGGAAAGCCTGTAGAACG ACCATGGGACTCAGCATTTC 445 FY231640
CLFL018_B02.f gSNP04480 TCATGAAAGAGCTGGGTGAA ACAGATGCCTGTGATGTTGG 434 FY231646
CLFL018_C10.f gSNP04482 AGCAGCGTCACACAAACAAC ACGAGTGCTTGGGTCTCTTC 415 FY231677
CLFL018_C11.f gSNP04483 GGGAGGTTGCACCTGTCTAT GCTCCAAAACCTTCATCCAA 448 FY231678
CLFL018_D05.f gSNP04486 TCGTGTGCTACTCCACATCC CTCTGAGGGGCGTTCTATTG 461 FY231696
CLFL018_D08.f gSNP04488 TTATTGGTCTCGTGCGAAAA GGTGGTCCTTGGATTGTCAT 415 FY231699
CLFL018_E06.f gSNP04494 TGGTCGGCCAAGGATTATAG AGCAAGGAGCTTGAGCAAAA 415 FY231721
CLFL018_E12.f gSNP04496 CGTCAGGGTTTAGAAGCAGC TGTTGCAAAGCTGTTATCCG 497 FY231727
CLFL018_E14.f gSNP04497 GACTCTGGTTTCGTTTGCGT TTGAGATTGAGATGGGGAGG 427 FY231729
CLFL018_G12.f gSNP04505 GATCTGCACAGGTGTTGGTG TTGCTGCTTTTGTCAGATGG 424 FY231774
CLFL018_G23.f gSNP04506 TCCATGATCTTTCCGGTCTC GCTTTGAACATCCCCCAGTA 484 FY231785
CLFL018_H08.f gSNP04509 CAATTTGGGGATAGTTGCTCA ATCAACCCCATTCCCCTTTA 456 FY231794
CLFL018_H13.f gSNP04510 CGTTGGGGATTGTTATTTCG TACAGAGGCATTGTGCTTGG 444 FY231798
CLFL018_H24.f gSNP04511 AACGTTCACCTCGCTGAAAT AGGTGCGACACCTGTTTTCT 419 FY231809
CLFL018_I03.f gSNP04513 GCGGGGTTCAGAGTACAAAA CACTCTGCAGTGGTTCCAGA 467 FY231812
CLFL018_I06.f gSNP04514 CGTGAAAGATACAGGCGACA TGTCGAAAGTTGATTGCCAG 432 FY231815
CLFL018_I14.f gSNP04516 GAAGTGCACGGGATCAATTT CGTGACACAACAAAATTCGC 480 FY231823
CLFL018_K11.f gSNP04524 TTGCGTTTGCAAATAACTCG AGATGGGCATCCATTTTCAG 468 FY231867
CLFL018_K21.f gSNP04526 GCATTCAACTCGTTAAGGGAA AGAAACCCTTGCTTGCTTGA 411 FY231877
CLFL018_L03.f gSNP04528 ACAGAAATGGAGCAGTGGCT GTTACCCGCCAGAGAGAGTG 500 FY231883
CLFL018_L08.f gSNP04530 CTTCCTTCCATTCCCAAACA GGGCCAACAGTCTACTTGGA 450 FY231888
CLFL018_N18.f gSNP04538 GTAGATGTGGTGGAGGCGAG CTTACCCTCCTTTTCCCCAG 423 FY231946
CLFL018_P13.f gSNP04543 GGGAGATCAATGCTTTGGAA AGAGCGGGAGGAGCTTAGTC 474 FY231987
CLFL019_A22.f gSNP04550 GATGATGGAGGAGATGATGGA TATGGGTCATCCTTTGGCTC 434 FY232020
CLFL019_B08.f gSNP04551 TGGGACATCAGAATATCGGC AGGTCGTGTACGTGAATGGC 430 FY232030
CLFL019_B14.f gSNP04553 CAATTGCATACACACTGGGC AATTTGCGTCTTTAGCCCCT 446 FY232036
CLFL019_B17.f gSNP04555 TCATCTGTTGCGCTTTTCAC ATGATATGCAAGCTGCCCTT 425 FY232039
CLFL019_C09.f gSNP04558 TGATGCTCATTCTGGTCCTG TGGCTATCACAGTTTCCACG 435 FY232055
CLFL019_C11.f gSNP04559 CTCTTCCTCCTCCTGGCTTT AGCAACAACATTACCGTCCC 492 FY232057
CLFL019_C13.f gSNP04560 CACCTGTGAATTTCTGCGTG TCCTCAGAATCCATCGGAAC 474 FY232059
CLFL019_C18.f gSNP04561 ATCCCATAGATCGTCAAGCG TGAGCAACGCACTTTAATCG 483 FY232064
CLFL019_C21.f gSNP04562 GCGATTTTGGCATCAGATTT CAAAGAAAAGGCTCCTCCAA 431 FY232067
CLFL019_E03.f gSNP04565 CATCAACATCATTCCTTGCG TTGGAAGAATACCCAGCAGC 482 FY232097
CLFL019_E23.f gSNP04567 ACTGAACTTGCTTGCTGGGT TTCTCCTGATCCCCACAGAC 428 FY232117
CLFL019_F20.f gSNP04571 CGCATCCAAATCGATTATCC AGTTACATTGCCTGGCTGCT 458 FY232138
CLFL019_G08.f gSNP04572 TGGCTGCCTCTCTCTCCTAC CCTCACAGATAATGCAGTGGAA 458 FY232149
CLFL019_G15.f gSNP04573 GCCAACTAGCCATAACCGAG GAAGGCGTGGAAAGGCTTAT 455 FY232155
CLFL019_G21.f gSNP04574 TTTGGGATTTTTGGGTGGTA CACAGAGCCCAAAAGGCTAC 495 FY232160
CLFL019_H10.f gSNP04576 AGCTGCCAGTCGTCGTTTAT TTACGACGACATCGATTCCA 435 FY232172
CLFL019_J01.f gSNP04581 GCTAAAAGGTGCGAAGGATG TTAAGCTTGCCCAAAACACC 467 FY232208
CLFL019_J08.f gSNP04583 ACCAGATTTTGCTTGGCATC TTCTGAATCTCGCACTGCAC 457 FY232215
CLFL019_J09.f gSNP04584 GAGCAAATTATGGAGGCAGC TGTTGTTTAGACTGTGCGGC 455 FY232216
CLFL019_L22.f gSNP04589 TGTCGGTTCAAGCAAAGATG CAGCAACAACCGGAAAGAAT 451 FY232276
CLFL019_N01.f gSNP04595 TGCTCTGATGGGTGTTCAGA ATGATAGCCAGCCCACAAAG 448 FY232302
CLFL019_N05.f gSNP04597 TGCGAAGTTCTAAGCTTCTATGG ACTTCTTTGAGGCACCATGC 372 FY232306
CLFL019_N16.f gSNP04599 CCTTAGAACAATTCGTCCGC AAATAAACGGCAAACGCCTA 444 FY232316
CLFL019_O13.f gSNP04604 GATGCCTCAAAATATGGGGA AAGCCTTTTGGCAGTCTTCA 438 FY232337
CLFL019_P23.f gSNP04607 ACTGAAAGAACGCAAACCGT GATGCCCACCATAAGACTGC 422 FY232369
CLFL020_A09.f gSNP04608 TCCGGATGCTCAACTTCTCT TTGCCAAGGAAAGAAAGCAG 427 FY232378
CLFL020_A11.f gSNP04609 TGAGGACGGAGAGAAACCTT TCTTCAAGGGCTTCTCCAAA 433 FY232380
CLFL020_C10.f gSNP04615 TACAACAGCACCACCGAAAA CTTGCTTCTGAGGCTGAGGT 490 FY232427
CLFL020_D02.f gSNP04618 TTGCAGCCATCAGAATTGAG ACACTTGCCTTGACTCGCTT 497 FY232443
CLFL020_E24.f gSNP04624 GCACACGATTCGTTCTTTCA TTTCGGATCAGGAGCTCAGT 449 FY232488
CLFL020_H01.f gSNP04628 CTGGGAATGTTTCCACCAAC CTTAATCCGACGTGCCATTT 495 FY232534
CLFL020_I02.f gSNP04630 GTAGCTAAGCGTCCCTCCCT TCCCCAAATTTCCTACCACA 464 FY232559
CLFL020_I06.f gSNP04632 TGGAATTGCAGAACATTGCT CCCACAAACTGCAACTCCTT 418 FY232563
CLFL020_I22.f gSNP04635 AGGGTTTGGATTGATTGCAG CAAAACATGTCCTGCCATTG 425 FY232579
CLFL020_K16.f gSNP04641 TGCCAAGAAAACATAAGGTCA CAAGCCTCTCTGGGTATGCT 468 FY232620
CLFL020_K19.f gSNP04642 TTCCTTCGCAGCTTATCTCC TTTTATTGCATGTTGGCCTG 517 FY232623
CLFL020_L02.f gSNP04643 GCGCCATGTAGAAGGAAGAA AACGACTCTGTCACCAAGGG 472 FY232629
CLFL020_M02.f gSNP04645 TTTCGTTTCATGTTTATGGCA GGGATCTTTGAGCAAAATGAA 416 FY232652
CLFL020_M03.f gSNP04646 CACCTTCCTGCAAAACCCTA CGCCTAAGCCCTTCTTTTTC 417 FY232653
CLFL020_N09.f gSNP04649 GATGATGTGGGGAATGGAAG CCCTCTTCTCCAACATTTGC 434 FY232683
CLFL020_O09.f gSNP04651 CCTGAAATTCTATGCGGGAA AGCCTTGGATTGAACAGCAC 488 FY232707
CLFL020_P03.f gSNP04655 AACGCTTCGAGCTCTGCTAC ACAATCTCCTGGCCTCTCCT 414 FY232724
CLFL020_P12.f gSNP04656 CGGCCAAATCTACACCATTT CGGTGGAATGAAACAAAATCA 445 FY232733
CLFL020_P21.f gSNP04658 TTGAGCAAGAGCAAGGGTTT CGGATTCCGATATCTCAATGAT 419 FY232742
CLFL020_P22.f gSNP04659 TCTCACTTGCTGAACCCAAA TTGCATTTCTGTTTTGCCAC 424 FY232743
CLFL021_A02.f gSNP04661 TTGCAGGGATAACCTAACGG TCCAGATTGTTCAGCACTCG 460 FY232747
CLFL021_D18.f gSNP04666 AGGATGTGCCTTATCGTTGG CAATTGCTAGCAGACACCCA 527 FY232833
CLFL021_E04.f gSNP04667 CCAGAGCTGTGAAAGTGGGT TTTTCTTGCTGCGACCTTCT 499 FY232843
CLFL021_E09.f gSNP04668 GGTAAACGGCCAGGAATTTT CTTGATTAGCCCTTTCGTCG 495 FY232848
CLFL021_G02.f gSNP04669 GATTGTTCGTTTTGTGCAGG CATTGAAGATGGAAAAGGCA 446 FY232889
CLFL021_H17.f gSNP04672 CATACGGGCTAGGGAAGTGA CCCCTCAACCTATTCAGCAA 472 FY232922
CLFL021_J03.f gSNP04674 CCGTCTTCTCCCTCTGTTCA CGCCTATACCAAAAAGCGAG 424 FY232956
CLFL021_L12.f gSNP04680 TTCACGTGCGATGGAATAGA AAATCAGTCGCATTCCCAAT 416 FY233009
CLFL021_M04.f gSNP04684 CGGCTTATGAACACCTCCAT TGCACAACCACTTTTTAATGTCA 496 FY233024
CLFL021_N08.f gSNP04686 TTTGCAAAATAAACGCGTCA GTGGAAAACCCAGTTGCATT 420 FY233052
CLFL021_O05.f gSNP04687 TCCATCTGCTACTTTTGGTGC GCTGCCACTTCATCATGCTA 419 FY233072
CLFL021_O12.f gSNP04688 TATGGGGAATGCCCAAAGTA CGGAGGGAAAATGAAGATCA 424 FY233079
CLFL021_P06.f gSNP04689 AAACGCGAATGGTAGGTGTC GCAATGATCCAACTAAGCCC 471 FY233097
CLFL022_A02.f gSNP04692 CCTGTGAAGGCCACAAATCT GCTTGCTACCTGGCTTTGTC 422 FY233114
CLFL022_A09.f gSNP04694 AGAAAGGGACCAGAAAGGGA GCTGAATCGATGGCTTCTCT 436 FY233121
CLFL022_C12.f gSNP04696 TGGTCTTTGGGAACGAAAAC AAGCAAAATCATGGGTCCAG 485 FY233172
CLFL022_G06.f gSNP04700 TCTGCCACACGTATCTCACC CCTGGCATTGTCCTGTTTCT 466 FY233262
CLFL022_I05.f gSNP04705 TCTGCACAGCTTGGTTTCAT GCAGGCTTCATTTCAGGTTC 421 FY233308
CLFL022_I07.f gSNP04706 TTGGGTAAGTGCAGTGAACG ACTCCTCAGAAGCCCAATCA 454 FY233310
CLFL022_I10.f gSNP04707 TCGGATCAACATTTCTGCTG AGGGTTTCAACATGATGGGT 432 FY233313
CLFL022_I21.f gSNP04709 CATTGATTTCGAGAGCACCA TGCCACGGAATTCAAATACA 424 FY233324
CLFL022_J20.f gSNP04712 GCCGATGATGCTCAAGATTT CCATGACTTCTCTGCCTTCC 415 FY233347
CLFL022_K03.f gSNP04714 TTAAGGGAGTTCAGAGCCGA TGATGGGCTCTTCGGTAATC 447 FY233354
CLFL022_K04.f gSNP04715 AGGTGCAGAGAATGAGTCGC CCCAGAGAGAGGCATTGAAG 528 FY233355
CLFL022_M04.f gSNP04718 GGAAATGGCTCTGCAGTCTC CACTTGGAATGGGGATTCAC 457 FY233403
CLFL022_M10.f gSNP04719 GTTTGTTCCACGATTGGAGG TCCCGATGTGTGAGAGATGA 484 FY233408
CLFL022_O09.f gSNP04724 ATTGCAGGGGTTTCTGATTG CCCAAGTCCAGGGCATAATA 471 FY233455
CLFL022_O21.f gSNP04725 CCCTGTATTTCGAAGAATGGC TGGTAGCAACAATCATGGGA 449 FY233467
CLFL022_O24.f gSNP04726 AGCTATCATGCGACCGTCTT ATTTGGAATCGGTCCAGTCA 502 FY233470
CLFL023_A12.f gSNP04728 TTGCATTTGCAGGAGAGATG GCAGAAGAAGATGGACTGGC 418 FY233505
CLFL023_B03.f gSNP04729 AGCTGGGTCCATGAAAGATG TGCAAATTTGTTGTAGTCCCA 434 FY233519
CLFL023_C01.f gSNP04730 GCTCCAACCAAGTTTTCTCC GCGAAACTCCTCCTCAGATG 462 FY233541
CLFL023_H10.f gSNP04734 ATTTTTGCCCGTTGATTGAG TCACACACTCAGAAACCCCA 466 FY233667
CLFL023_I20.f gSNP04735 ACTGGAATCCAACCCAGAAA TCAGGAGTCTGCATCTGGTG 456 FY233701
CLFL023_K07.f gSNP04738 TTCTCTTGCGAGCTCTCCTC TAGCCTGTCCAAGTCCCAAC 432 FY233735
CLFL023_L03.f gSNP04739 GCATTGCACAATCACAGGAA CACTGCCTGAAAACACTGGA 513 FY233755
CLFL024_A18.f gSNP04744 ACCTTTTCATGCCGTCAAAC GGCAGGCAAACGGTTATTTA 494 FY233882
CLFL024_B11.f gSNP04746 TGAATGTTGAATTGCATGGC TGCAATTCTTTCCGCCTAGT 430 FY233895
CLFL024_B12.f gSNP04747 TAGGCAGGAAAAATATGCCG TTCCCTGTTGTTTGCGAAAT 422 FY233896
CLFL024_C09.f gSNP04751 TGCAAGTGGTTCAAACATCG TCACTTAGAGCTGAAGCGCA 463 FY233917
CLFL024_D02.f gSNP04754 AGTAGCAGGCAATGGAGTGG ACATTTATCCGCGCATTTTC 439 FY233930
CLFL024_F12.f gSNP04760 CGGGCTATCTCAAATTACCG CGACCTTAAAACCCTTGCAG 425 FY233984
CLFL024_G08.f gSNP04764 GCGCTTGTTAGCTCTCTGCT GTCACCCGCCGACTATAAAA 461 FY234000
CLFL024_G19.f gSNP04767 CGGATACTGCCGTCTTGAGT GTCGTAAGGCTGGGTGAAAA 417 FY234009
CLFL024_H08.f gSNP04768 TGCCCTTGGAAGCTAGAATG GGAGCGAATCTTACAGCCAG 427 FY234018
CLFL024_H11.f gSNP04769 CGTAAATCTCCAAAGGGCAA GGACCCTAATGGGCTTTTTC 456 FY234021
CLFL024_H24.f gSNP04771 AACGCTAGCACGGAAAACTG CTCAACTTCCCTTCCCTTCC 435 FY234034
CLFL024_K01.f gSNP04778 TTCATGCCATTCCAATTTCTC GGTGTTTGATGCAAACCAAAT 431 FY234076
CLFL024_K14.f gSNP04782 TTCCCCTGTTCCACAAAATC ATACGCCATCCAGACATGGT 427 FY234089
CLFL024_L06.f gSNP04784 AGGCAGGAGAATCAATCCAC TTATCCTTCTCCAATCCCCC 420 FY234101
CLFL024_N18.f gSNP04789 GTGATGGAAGTGCACGACAG CTCTCGCCTTCTAGATGCTCA 448 FY234155
CLFL025_B20.f gSNP04798 GAGGTGGAGAATGTGTTGGC TTTTTCTTCACAATACTTTTCACTCC 413 FY234249
CLFL025_C15.f gSNP04802 TGCCTTGTGTTCAGTGCTGT GTCCCAATCACAGGCAGAAT 424 FY234267
CLFL025_C16.f gSNP04803 TATCCGCCACCAGAAGAATC CGTCAATCTGGCAATCTTCA 437 FY234268
CLFL025_D21.f gSNP04807 TGGACATGCCGAATAAGTCA TGTCCTTCCCTGCTGTTTTC 441 FY234297
CLFL025_D24.f gSNP04808 TTAAGCTTTGCCAAGTCCGT CTGCCTCCTCTCTGAACACC 467 FY234300
CLFL025_E07.f gSNP04809 TCTGAGGATTGAAACCAGGC AAAAGCTTGGATTCTTGGCA 395 FY234307
CLFL025_F04.f gSNP04813 AGAGTTCAGTTTCCATGGCG CAAACCATTTTCTTCCTTGAGC 428 FY234328
CLFL025_F12.f gSNP04816 ATCATATTCGCGCTTTGGAC GACTGCACCAGGCCTAAATC 426 FY234335
CLFL025_F18.f gSNP04818 TATGGAACAACTCAAGCCCC CGGTGTAGACCAAGGCGTAT 438 FY234341
CLFL025_F20.f gSNP04819 CTATTCCGCTGCGATGAAAT CATCTGATCCTCCACCCATT 423 FY234343
CLFL025_F23.f gSNP04820 TTGGATTACTCAGTCGCTGC TTTCTAGCCAGGCATACGCT 445 FY234346
CLFL025_G17.f gSNP04822 GTACCCAAACCAAGCAGAGC TGGGTTCTGCAGACCATTTT 415 FY234364
CLFL025_J14.f gSNP04832 GCGTTTGAGGCTTTCTGAAC TGGCGCAAAGTTCTTGAGTA 445 FY234427
CLFL025_K09.f gSNP04834 AAACGAACAGGTTTGCTGCT CGAGATAAATCTGGGAACCG 426 FY234446
CLFL025_K11.f gSNP04836 ACCTAGTTGTGGGAACGAGC CCCCAGGCATCTCGTACTAA 460 FY234448
CLFL025_L08.f gSNP04839 TTCATCGGCTCATTGAAGTG TGACCGGCCTCATCATATCT 437 FY234468
CLFL025_L11.f gSNP04840 GGGTCTCCTCGTGCTTTCTT CTGATCCTCTTTCCCAACCA 426 FY234471
CLFL025_M01.f gSNP04847 TGATTTCTTGGGGGCATTTA GGTCAGCCACACAGAGTTGA 435 FY234485
CLFL025_P11.f gSNP04859 TCTCTGCAGCAGGCAAGTTA CGCCCGCTGACTAGATTAAG 449 FY234564
CLFL026_A14.f gSNP04864 ATGTGTTTCTCAGCTTTCGC GGACCAACCAGAGACACCAG 428 FY234591
CLFL026_B16.f gSNP04870 AGAATAGGATTCTCGGCGCT AAAGCGAGGATGCAACAGAG 450 FY234615
CLFL026_B18.f gSNP04871 GGGAAAAATTGCAGAGGTGA ACCAACCTTGTGGTGGACAT 421 FY234617
CLFL026_C07.f gSNP04873 CTTCTGTTTTTCCGGCTCTG GAAGCTCTCAGGCCTTGTTG 429 FY234629
CLFL026_C08.f gSNP04874 CGTTGGAGGACCGATAAAAG CCTTATATACGCGGCCAAAA 436 FY234630
CLFL026_C09.f gSNP04875 TGTCGGATCTGTCGTCTGTC AGTTGCACTCCTGCCAGTCT 489 FY234631
CLFL026_E02.f gSNP04881 GGTCTCGACAGACCCACATT ATGCCTGCAGAATCGTAACC 420 FY234672
CLFL026_E24.f gSNP04884 CGAGAAAGGATGCCATGAAT TTGCAAGCATTTCATTCAGA 462 FY234694
CLFL026_F16.f gSNP04886 TTTTGTGGAGTCGAAAAGCC CGAGAATGAACACCGTGAAA 427 FY234710
CLFL026_F19.f gSNP04887 TATACTATTTGGCCAGGGCG TTCCAAACCCTCACATCACA 447 FY234713
CLFL026_I03.f gSNP04893 CCAGATCATGTATGGACGGA AGCTTCCTAAAGCCACAGCA 456 FY234765
CLFL026_I12.f gSNP04895 AACCTCCGGAACGTCAATTA GAGAAATCCCCAGAAGGGTC 440 FY234774
CLFL026_J02.f gSNP04896 CGACCCCTCCTTTACATTCA CAATCGGCTTCCCTGAATAA 477 FY234788
CLFL026_K03.f gSNP04898 TCACGTCTAGCATGCAAAAGA CAGTCACACTTGATGCCAGG 453 FY234813
CLFL026_K06.f gSNP04899 TTTTTAAATCATCGGGGCTC ACCCACTAAATTCCCGATCC 449 FY234816
CLFL026_L14.f gSNP04903 TTGAAGCTGTTGCAGACGAC TCCTCATCACGACTTTCCAA 418 FY234847
CLFL026_L18.f gSNP04904 ATTGCGGAAACACAGTGGAT AGCCCAGTTGGTTAAGATGG 414 FY234851
CLFL026_M08.f gSNP04907 AATCTTTGTTTGGCAGGCAG TTTTGGCCTTTGGAAGAATG 486 FY234865
CLFL026_O14.f gSNP04916 GTGACTGCGTTTTGCAGTGT TGCTGTTTTTCTCACACCCA 437 FY234917
CLFL026_P07.f gSNP04922 TTTGTTGGAAGATTTGAGCAGA GACAAAACAAAGGCCTGAGC 478 FY234933
CLFL026_P12.f gSNP04924 AACGGTTTGCCATCTTATCG TGCTCAACTAGAGCGGATCAT 421 FY234938
CLFL027_A09.f gSNP04927 TGGTGGAATGGCTCTTATCTC TCCACTATTGGCAAGCACTG 444 FY234959
CLFL027_B19.f gSNP04931 TGTATTTGCTGTTTGGAGCG TCTCCTGTAGGGGAGAAGCA 434 FY234992
CLFL027_C08.f gSNP04934 TTTCCTTGCTTTGCAGAGTG AGGGTTTCAGGAACATGTCG 510 FY235005
CLFL027_C10.f gSNP04935 TCAATAATGAAACAAACCAAATTGA AGGGCCCACAAAATAGGACT 440 FY235007
CLFL027_C15.f gSNP04937 CCCCAGATTGAAAGAAGGGT CGATTCCATTATCACGGAGC 415 FY235012
CLFL027_G08.f gSNP04940 GCATATTTGTCTGTGTTTCCGA AGAAAGACAATTCAGCCGGA 511 FY235098
CLFL027_H18.f gSNP04941 CGTGTCGTGATGTTTCCTTG CGAGCTGTCCTTCTCCAAAG 442 FY235132
CLFL027_H23.f gSNP04942 TATAGATTTGCGTTGGGGCT AGCGGGAAACACATTATCCA 434 FY235137
CLFL027_I05.f gSNP04943 GGTCATGGAGTGCAGAGGTT TGCACTCAGTCATGTTGCTTC 475 FY235143
CLFL027_I07.f gSNP04945 TGAGGAGGATTTGTGAAGGG GCGCATTAATTGAAGGGACA 502 FY235145
CLFL027_I10.f gSNP04946 CCACGGGTCAATAGTCTGGT TGCAAGGAAGTCACCATTCC 433 FY235148
CLFL027_L05.f gSNP04950 TAAAGGAGCTCCAAGGCAAA TTCCATAGTATTGCGAGCGA 444 FY235213
CLFL027_L11.f gSNP04951 GTGATTTGGAATAATGGGCG GAAATGCCCAATTCGAGAAA 500 FY235219
CLFL027_O14.f gSNP04958 CAGCAGAGTAGCTGCGAATG ACCCCATTGCTACATCGTTC 431 FY235293
CLFL028_C22.f gSNP04964 TTGTTTGCAACAGCGAAAAG GCTTCCACCACTCGATCTCT 417 FY235393
CLFL028_D08.f gSNP04966 AGCATGGGTATGTGCTCGAT TGGCTAATCCCATTCTCAACA 421 FY235403
CLFL028_N20.f gSNP04975 AGGTCGAAGTTTACCAGCGA AAGGCCAATTCCATTTCTCC 439 FY235644
CLFL028_O22.f gSNP04978 GGGCAAATATTGGTGCTCAT AAGAAGAGGAAGAGGGGCTG 472 FY235669
CLFL029_B20.f gSNP04983 TTTTTGTTACCTTCTACCTTCAAATG AAAAACATGGTACCCCTTAAAAA 468 FY235733
CLFL029_E21.f gSNP04993 GAACAGTTTGCCCATGTGTG CCACTTGATTTGCCCGTACT 499 FY235802
CLFL029_G23.f gSNP04997 TGGCACAAGGTCACATCAAT GGGTACTGGTTGCGTCAGAT 466 FY235844
CLFL029_I07.f gSNP05000 TTCCGCCATTTGATGTGTTA CAGCTACAGCAATTCAGCCA 507 FY235870
CLFL029_I19.f gSNP05002 GTTGCACAAACATGGACGAC GAAGATGAAGACGGGAATGC 454 FY235882
CLFL029_K17.f gSNP05003 TGGCATTAGGTCTTCGGTTC TCCAACAATAAACATCCCCG 429 FY235922
CLFL029_O15.f gSNP05013 GCTTGAATGCATAGATTTCCCT AATGGGGACAACATCCACTG 490 FY236006
CLFL030_B06.f gSNP05017 GGGTTGCATGAATTTTGCTT CGACCACCTCACATTCACAG 434 FY236065
CLFL030_B14.f gSNP05018 TGGATCGACGTGTGTATCGT AGTGCACGCCTTGAGATTTT 417 FY236072
CLFL030_D06.f gSNP05020 AATTCGACGAACTGGAATCG TTCAGATGCCCAATACGACA 470 FY236111
CLFL030_E23.f gSNP05022 CTCGAAAACCCTAACATGGG TTGGAGACCATGCATCAAAA 458 FY236151
CLFL030_G11.f gSNP05025 AAATACATCCATCGTTCGCC TTTTCGACATTGGAGCCTCT 418 FY236183
CLFL030_H02.f gSNP05027 CCCCGGTAGCAGAAACAATA TAGCACTCACGGTGACAACC 464 FY236196
CLFL030_H16.f gSNP05030 TGATTTGCAAGAACCCATGA AGCTTTAGGGTTTTCTGGGC 423 FY236210
CLFL030_J16.f gSNP05032 GATGCAAGCTGGATGAACAA GTCGGGATCATACCCACAAG 475 FY236258
CLFL030_L02.f gSNP05034 GAGGATCTCGACGTTCGTTC TTTTCGCTCCCCAATATGAG 444 FY236291
CLFL030_L06.f gSNP05035 GCATTTTCGGAGCTTCAATC CTGAACTGGGAAATCAGGGA 420 FY236294
CLFL030_L08.f gSNP05036 TCCGATTGAATGTTATTGATTGTT TCTTGGGTTGAATCCTTTCAG 459 FY236296
CLFL030_M15.f gSNP05037 TCATGGGTTCTTTGGGAGAG TCAAGCAGTGCCTTTTGATG 421 FY236327
CLFL030_M17.f gSNP05038 ATTGGAAAGCTCCAAACCCT CATCTCCCAACCCTGAAACT 425 FY236329
CLFL030_O05.f gSNP05039 CGTGTCCTCTTCTGAAACCC TGCTACTTCCAACCTTTGGC 433 FY236364
CLFL030_O07.f gSNP05040 GAGATCCGAACATGAGGCAT GATGCTGATCAAGCAGTGGA 420 FY236366
CLFL030_O17.f gSNP05041 AAATTGATGGGGTCACCAAA TGATCACTGAACGGATGTGC 417 FY236376
CLFL030_P18.f gSNP05042 ATGCCACCTCAATAATCCCA ACAAATCCCAATTTGAACCG 421 FY236401
CLFL031_A03.f gSNP05044 CAGGGGCTCAAATTAGGGTT GAGCTGCGAGAAGTTGGAAG 444 FY236409
CLFL031_A13.f gSNP05048 AAGGCAAGTTAAGCACGGAA TTATCAGTCCGCCCAGGTAT 517 FY236419
CLFL031_E13.f gSNP05057 TGGCTTCTTCCCAATATCCA TGCTTTCAATTGACATCCCC 441 FY236511
CLFL031_E16.f gSNP05059 GGATGGACTTGGTAAAGATGGA TGCACAAGCATCATCATCAG 412 FY236514
CLFL031_E21.f gSNP05060 AGAGGAGAGATGGGGATGGT AGTGCTGCTATGGCGAAGAT 444 FY236519
CLFL031_F05.f gSNP05061 TGATGAGATTGCAGGAACCA GCAAAAGACGTGAGACACGA 427 FY236527
CLFL031_F09.f gSNP05062 TGTGATTGTTGAACGGAAGC CCATGGATGTCACTCCTCCT 418 FY236531
CLFL031_H19.f gSNP05068 ACACTGGGAGGACGTGGATA GGATTCAATGGATTTGGGTG 432 FY236583
CLFL031_J21.f gSNP05072 CATGGGGTTTTCTCTCCATC AGGCCAAGGTGAACATAGGA 436 FY236624
CLFL031_M11.f gSNP05075 GCTTTATTTTGCAGGCGAAC ACGAAGTGACCCAAAAATGC 423 FY236682
CLFL031_M21.f gSNP05078 CTCCATCCATGGTGAAGGTC CGCCCATTGATTTCATTTCT 447 FY236692
CLFL031_O06.f gSNP05079 GCAGTGCCTTCCCTGATAGA TGGAGGAATTCATCACCAGC 418 FY236723
CLFL031_P05.f gSNP05084 CTGTAGGAAGCATCGGAAGG CATGGATCAAAAGCAGGGTT 511 FY236745
CJ051109_Contig11 gSNP05086 AAGATAACCTCCTCAGCGCC GGCTTTAACGCCAACAGATG 474 BJ937932 DC432774 BP176534 BY880017 FY231800
CJ051109_Contig16 gSNP05088 AAATGTCAGCGCAGTGTCTG CGTTATATTTCGACGCCGTT 518 BY881487 BY882369 DC432738 BY879462 BY887210 FY229861 FY231618 FY229757 BY879021 FY234941 BY895863
BY890588 DC430182 BY878589
CJ051109_Contig37 gSNP05094 GTCACCTATTGGTCGGCAAC CAGCAAACTGCCAGAATTGA 447 DC432626 DC431240 BY886487 DC431458 BP175858 FY236561
CJ051109_Contig46 gSNP05096 CCCAAAATGGCTGAGAAGAG GGGTATTTGGGGTCGAGAAC 320 DC431445 DC431093 BY881524 BY893450
CJ051109_Contig52 gSNP05097 TCCTTGCTTCAGAATCCCAC CCAGTCCACAACCACAGATG 480 DC432496 FY235848 FY230409
CJ051109_Contig78 gSNP05100 CTGTTTCTGCAGCGTTTCTG ACCTGGATGAGAAGAAGGGG 476 DC432347 DC431009 AU085070 FY227750 FY234158
CJ051109_Contig82 gSNP05101 GAGCATTTTCGCGAGTTAGG TGGGAACAATCATGCGAGTA 511 DC432315 BY884887 BY892094 BY892746
CJ051109_Contig89 gSNP05103 ATACGCAGCCTCTCAGCAAT CCCCGAAGCATCTAATGAAA 462 DC432234 BY878922 BY895459 FY230528 BY886666
CJ051109_Contig97 gSNP05105 GCTTTTCTTATCACCTGTTCTTCC GCCATTCGTGCTTCTTCAAT 397 DC432176 DC430891
CJ051109_Contig116 gSNP05109 TTTCCCCTCCCCTTTCTTTA GTGATGGGCAGCTTCTTCTC 544 DC432073 DC431651 BY885263 FY227896 FY229623 BY894436 FY235146
CJ051109_Contig148 gSNP05113 CTCTGCCTGCTCGGTACATT CGCCCATGTAAGCCAATACT 519 DC431787 DC431399 BY880074 BY896491
CJ051109_Contig182 gSNP05118 ATATCCGGTCAAACCATCCA GCGTTAGGGTTTGCAGTAGC 567 DC431575 DC431516 FY234198 FY228964 FY226783 FY225834 BY889727 DC432532
CJ051109_Contig185 gSNP05120 CAGTTAGAGTGCAAGAAGGCG CACCCAGATGACATATTCTGC 324 BY881856 DC431491
CJ051109_Contig190 gSNP05123 GGCCTCGTGCTGTACGTAGT AGGACACTTGACACGGCATT 459 DC431590 DC431468 BY882967 BY890449
CJ051109_Contig198 gSNP05125 CCCTCCTTGAATCAGACCAA CACGATGGAATCAACTGTGC 490 BY889277 DC431353 DC430541 FY226854 BY895162
CJ051109_Contig205 gSNP05127 GATCTATTTATAGTAGGTGGTGGTGG GCTGCTTGTTGCTGTTGCT 500 DC431310 DC430631 AU299009
CJ051109_Contig216 gSNP05130 AACATCAGCTACCAGGAGGC TAAAGCAGCCCTCTCTCAGC 470 BY889231 DC431244 BY890083 FY228231 FY226214
CJ051109_Contig219 gSNP05132 CGCTAAAGAAGCTGCCAAAT CGGAAATTCCTTGAACGTGT 319 DC431213 BJ940217
CJ051109_Contig232 gSNP05136 GGGGGAAAAAGAGAAACAGG ACAATGGGCTTCTTCCAGAG 414 DC431087 BY880698
CJ051109_Contig240 gSNP05138 CAAGTGGGCTTTTCTTTTCG GAAAACAGAAGGGTCGTTCG 421 DC431055 AU084838 AU084720 AU084271 BY880143
CJ051109_Contig256 gSNP05142 GATAGGAAGGGAGGGTTTGG GCTGCCTCACTTCATCTTCC 511 DC431006 BY882663 BY879920 FY231206 BY896141
CJ051109_Contig279 gSNP05148 AGTGATGGTGCTTCCCTTCC AACGTGATTCCATGGCCG 369 DC430867 BY889496
CJ051109_Contig300 gSNP05152 GTCTTCTCCCAGCTTTCGG ATCACGCCGTTAAATTCTGG 511 DC430692 FY229316 BY892866
CJ051109_Contig304 gSNP05154 TTCTGCCTCGCTCTTCTCTT ATGAAATGGGATTGGAGGTG 321 DC431930 DC430618 FY228529
CJ051109_Contig307 gSNP05155 TTTTCCCATGCGTAGGAGTC CGATCGGATACTCTTCCTCG 489 DC430606 FY231830 FY231781
CJ051109_Contig314 gSNP05156 GGCAGAAGAAGCGAGAAGAA GGCTCTTTCTGTGCCCTACA 328 DC431126 DC430544
CJ051109_Contig318 gSNP05158 CTGTCATAAATCCGGTGCAA GATTTGGGGCCATATCCTTT 506 DC432446 DC432017 DC432063 DC432005 DC430535 FY225570 FY229817 DC430417
CJ051109_Contig327 gSNP05160 CAAATCTTTCGGAGAAGCGA AAAGAAGTGGTGTTGCGAGG 527 DC431017 DC432573 DC430462 DC430183
CJ051109_Contig329 gSNP05161 TGTTCCCGAATACCCATTTC GCTTGGCACCAATGGATTAT 422 DC430449 BY889874
CJ051109_Contig336 gSNP05162 CACGAGAAACCTCTCGAAGC CGAATGCCTAACACCGATCT 520 DC431522 DC431349 FY235201 DC430418
CJ051109_Contig361 gSNP05169 AAGCGTGCAATTTCGTTTTT TAGCTGATGGGATCTTGGGA 464 FY229910 DC430253
CJ051109_Contig377 gSNP05174 TGAATTGTGCCGTCTGAGAG TGGGTCGTAAACCACAATCTT 475 DC430155 DC429997
CJ051109_Contig379 gSNP05175 CCACGCTTCTTGGTCAAACT CCATCCCCAATAACCCTGTT 561 DC430129 FY234740 BY880863
CJ051109_Contig388 gSNP05177 CAGAGAGGAAAGAAAGGCGA TGCAAAATTCAAGAGCTCCA 594 BP176477 DC430080 FY225845 FY225711
CJ051109_Contig389 gSNP05178 GGTGGGTGACTGTGAGTGTG GGCCGTCAATTGTCTTGAAA 501 FY229842 DC430071
CJ051109_Contig394 gSNP05179 CCATGGCAACATAATAAAACACC CAAAACCCTGACGCACTTG 523 BY881447 DC430060 FY225926
CJ051109_Contig396 gSNP05180 ATCAATCGCTTTGTCTGTGAAG TTAAATTGGGGAATCGATGG 429 DC430056 FY231448
CJ051109_Contig398 gSNP05182 TCTGTGATGTTAATCGCTTGC GGTCTGTGCTTCTTCTCGCT 505 DC432540 DC430040 BW993864
CJ051109_Contig413 gSNP05186 AGCCAAACTTGGAATACCCAC CTAAACACAACAGTTGCCGC 462 DC431169 DC429946
CJ051109_Contig426 gSNP05191 TGCTTCATTTGTGGTGGGTA TGCCACTCATGAAAGCACTC 505 BY884703 DC432700 BY894379 FY227083 DC429862 BY888768 FY232633 FY231232 BY893998
CJ051109_Contig431 gSNP05192 GCTCCAGAGAGATACACGGC CTGGTTATACCGCAGGGTGT 535 DC429826 FY226055
CJ051109_Contig435 gSNP05193 GCACTCTGCGCTGACAGTAG AGTCAGAGGGATCCCCAGTT 529 DC430515 DC429805 BY878757 BY880088 BY892574 BY893245 FY229084 DC430181 DC430302
CJ051109_Contig531 gSNP05196 AGTTTGTTGGAATTGCAGGC AATTCCCCAGCACAGATGAG 468 BY882968 BB941588 BB941559 BB941016 BB941135 FY229726 BB941064 BB941562 BB941289 BB941489 BB941319
CJ051109_Contig557 gSNP05197 CAGGAAACCGAGTTTTTGGA CAAAGCATTCAATCGAGCAA 401 BB940882 AU085028 AU299765
CJ051109_Contig645 gSNP05202 CGGCATAATATCAAGGGCAT TCTCTCCAGATTCGCTATCCA 403 BJ938301 BJ938158
CJ051109_Contig674 gSNP05203 CTGATGAGAACGGATGAGGC ACTGCAGGCATTGATGGAC 431 BJ938063 BJ940113 BJ938414
CJ051109_Contig697 gSNP05205 GAGCACAAAACAAAGTCCCC GCCATGTGAGTTTTTCATTCC 316 BJ937889 BJ937905
CJ051109_Contig737 gSNP05208 AAGCTGGCGAGCACTATGAT AAGGTGATTCGATCAGGCTC 326 BJ937520 BJ937628
CJ051109_Contig754 gSNP05210 CGGATGTCAAGGAACCCTAC ATCGGCCCTAATGGAAGTCT 420 BJ937480 BJ938983 BJ939920
CJ051109_Contig873 gSNP05214 CCACGTTGGAACCTGGATAA CCGCCTCTGTATCTGCTTGT 428 BY895538 BJ939977
CJ051109_Contig876 gSNP05215 GGGTCTCAGGGCCTCTTTAC CCCTAAGAAGGCCAAACACA 400 BJ939942 BJ939581
CJ051109_Contig877 gSNP05216 TGAATACAAGGAGGCCAAAGA ACTCAAGGATGCAGCCAAAT 508 BJ939914 BJ937764 BJ937610 BW996522
CJ051109_Contig912 gSNP05218 CTGGAAAACGATCAAAGCAA ATTTTCGGCCTTGACAACAG 400 BJ939683 BJ939708
CJ051109_Contig937 gSNP05219 ATGCTGATTAGGCATGCTCC CCTTGCGAATTTGTACAGCA 456 BJ939492 BY880732
CJ051109_Contig998 gSNP05223 GAATATTTTACGCGCATCGG GTGACAGCTGTGAAGGCAGA 421 BJ939021 BJ939474
CJ051109_Contig1037 gSNP05225 GGACATAAGGAGTTGCTGCC TGATTTTGCAGCCTCAAGTG 455 BJ938742 BY894532 BY885193
CJ051109_Contig1052 gSNP05228 CTTTTCTGTTTTTGGGGCAG CCTGACTCGCTTACCTCCTG 541 BJ938654 BY884638 FY226295 AU299125 BY886148
CJ051109_Contig1187 gSNP05234 CTAGTCTGACCAGAGCGCAG AGCGGTTGGGTTGAATAGTG 402 AU299480 FY227740
CJ051109_Contig1193 gSNP05236 AACAAACCAAACAACCAGGC TCCATAGCTCAGATTGCCCT 506 AU299423 BY883362 BY895083 FY228329 BY894788 BY880522
CJ051109_Contig1223 gSNP05245 TTCTCTGTTTTGAGGGCACC ATCTGCCAGTGCCTTTATGC 327 AU298944 FY227776
CJ051109_Contig1272 gSNP05248 AATGCCATTTTCACCAAGCTA GCAAATTGCTTTCCCAGATT 421 BY881873 FY233267 AU299442
CJ051109_Contig1328 gSNP05257 TTTACAGCAAAAGCCCCAAC TTCCCCACACTGGCTAAAAC 480 DC431655 AU085048 DC431157 FY226070 FY226620 FY227481
CJ051109_Contig1333 gSNP05258 CTTTGCCAAATTTCGTGAGA GTTTAGCAACGGCAATCCAT 442 AU084965 FY235140
CJ051109_Contig1338 gSNP05259 TGCAAATCATGAGTGTGGGT CCATGCCTTACAAACCAATG 534 AU084912 BY881050 BY892123 FY236489 FY232317 FY232058 BY892252 FY229344
CJ051109_Contig1344 gSNP05260 CCCCTAAACCCTTAAAACCC CTGCAATTCCTCGAGGTGAC 301 AU084845 FY234489
CJ051109_Contig1358 gSNP05264 TGGAGAGATTTTGTGGCTGA GTGGTGAGTCCAGAAATGCC 328 AU084711 BY883020
CJ051109_Contig1370 gSNP05266 AGCTTAACGGGCGCAGAC TGAAATCAACATGACCAGGTG 431 AU084612 BY889905
CJ051109_Contig1383 gSNP05267 GGCTCTGTTTGGAGAAAAGG TGGTGTTTCTGCCATCATCT 367 AU084501 FY230123
CJ051109_Contig1388 gSNP05269 CACCTCGGATTAGAAGCTCG CAGCCATCTTCATTCTCTTTGA 349 AU084448 AU084334
CJ051109_Contig1394 gSNP05272 GCAGGAACTCGCCCTTAAAT AAAGAAAAAGCCGGTAACCAA 488 AU084403 BY885615 BY880944 BY894471 BY893482
CJ051109_Contig1410 gSNP05275 TTGATTCTGATGGGTGTGGA TATGGCAGGCCTTCACTTCT 354 AU084255 AU084254
CJ051109_Contig1460 gSNP05281 GGACAACGGATCACCTTCTT AAATTTTCTTTGTCTTGGGGC 413 AU083885 BY881556
CJ051109_Contig1522 gSNP05288 ATGAAACCTCGCACCACTTC TGAGTTTGTTATTCGTGCGG 355 BW996882 AU299987
CJ051109_Contig1541 gSNP05289 TGTTCTGTGTCAACCACCTGA CACAACCTTCAATATCCTCCTC 405 BW996661 AU300238
CJ051109_Contig2195 gSNP05301 TGCATTAAACCTGATTGGCA GTCCACATTTTCCACCGAGT 503 BW992946 BY891843
CJ051109_Contig2201 gSNP05302 TCCAGATGTTGTAATGGCGA AAGCAGAGACTTCAAACGGC 568 BW992925 BY886463 FY229119 BY891646 AU298868
CJ051109_Contig2215 gSNP05303 TTTTCTCGCGTAAACCTGCT TGGGAATCAGTCCTGTTTCTTT 330 BY880468 BW992826
CJ051109_Contig2239 gSNP05305 AAGACCTAGGCCACCTCGTT TGGACTTCCCTAGCTTCCAT 485 DC432761 BW992697
CJ051109_Contig2308 gSNP05307 CCCTCTGATTTCCCCAAAAT GAGAACAAAGGCGAAAGAGC 523 BY881963 BY881345 BW992331 BY895765
CJ051109_Contig2320 gSNP05308 CATCACAGGCGTTAATGTCG CCCTCAGTCCCTTCATCTCA 536 BP175774 BW992279 BY895183
CJ051109_Contig2340 gSNP05310 CATGAAGTCGCAGCAAATGA CTTCTGAAGGCCACTCTTGC 362 BP176648 BY881132
CJ051109_Contig2354 gSNP05311 CGTGGATGAGGTCTCAGGAT GAAATCCGCATGTTGAGTGA 475 BY882512 BP176546 FY230039 FY228029 FY225700
CJ051109_Contig2360 gSNP05313 CAGAACAACATTTAGCGGCA AAAATCAGATGGAAAGGCGA 404 BP176498 BY880193
CJ051109_Contig2390 gSNP05316 AGGCCAGAGCAGATTTCTCA TTCATCTCCCCAGCAACTTC 328 BP176348 BY887048
CJ051109_Contig2681 gSNP05326 AGATGGAATCAAGGTGACGG TGCCATGCATTAACAGGGTA 478 BY877916 FY236700
CJ051109_Contig2689 gSNP05327 GAATTACAGGCCACGGATGT ACAATTGGGAAACAACCCCT 400 BY877946 BY891910
CJ051109_Contig2692 gSNP05328 TCCCACAAGCATTTTCAGTG CGGGCCATATGTTTCTTCTC 346 BY877961 BY889838
CJ051109_Contig2693 gSNP05329 AGCGATGGAGGAGGTGAAAT GGCGTCGAGAAGTTTGTCTC 403 BY877968 BY890466 BY895812
CJ051109_Contig2729 gSNP05343 AGCAAAGCGAATTAAAGGCA CCCCTTGGTGCAAGAAAGTA 518 BJ937097 BY878089 DC429864
CJ051109_Contig2731 gSNP05344 AGATGCCAAAGGATGCAAAG AGCTTGAGTCCCTGCATTGT 338 BY886204 BY878095 BY879835
CJ051109_Contig2743 gSNP05351 ACCCAAATGTCAAATTCCCA AAATGGTTCGAAGATGCCTG 451 BY878135 BY886216
CJ051109_Contig2744 gSNP05352 ACAAACCCAAGAAACGACCA ATCCAGCGTGATGATTGACA 552 BB940621 BY878136 FY231089 FY231937 BY879731 BY894039
CJ051109_Contig2746 gSNP05353 ACACAACAGGGAGGCAAAGT GACATAGTCTTGGCCGGGTA 512 BY878140 BY888097 BY892484 BY879323 BY881677 FY230577 BY891838
CJ051109_Contig2755 gSNP05357 ACTGACGGAGGGTTTGAAGA TTCACAGTTGCCCACTGAAG 508 BY886579 BY878160 BY886918 BY895895 FY227361 BY891487
CJ051109_Contig2756 gSNP05358 TTGAAGGCTTTCCCAATCAG TTGCCCTCCAATAAAGAACG 311 BY878166 DC432680 AU084665
CJ051109_Contig2767 gSNP05361 TCATACGATCGACAAGGCAA GAAGCTTCGATTTCAACGGA 443 BY878217 BY884507
CJ051109_Contig2774 gSNP05365 TGGGCTTTATAGTTTGGTAGGC AGTGAGCTTCCCGCAGAGT 416 DC431241 BP175876 BY878234
CJ051109_Contig2777 gSNP05366 TTGGATTTTGAAAGAGGGGA CGTCACCTGACCCACTGTTA 454 BY886237 BY878239 BY893586 BY891676
CJ051109_Contig2790 gSNP05370 ATCCTCATTCTCCCACAACG CCCTGGACTTGCCATCTAAA 457 BY878294 BY885856 BY888691 BY883012
CJ051109_Contig2791 gSNP05371 GTTTTTGCCCTTGCTTGTGT TTGGTTCCTTCGACTCCATC 425 BY878295 BY882114
CJ051109_Contig2801 gSNP05376 TTAGTCACCACTCCGCTCCT ACTCTGGAACCCCCTCCTC 364 BY878337 BY891690 BY885272
CJ051109_Contig2807 gSNP05378 GCACTGAGATTAGGGAGACCA ATATTTGTTGCCCCTTGCTG 375 BY878351 BY880743
CJ051109_Contig2814 gSNP05383 ACTCGTCCAGTCCCCTCTTT TTGTTCAAAGGGGTGAGGTC 486 BY878366 BY887710 BY890485 BY884646
CJ051109_Contig2815 gSNP05384 CAGGCAGTGAAACATTCCAA TCCTCAAGATCCGTCACAAA 314 BY878370 FY229764
CJ051109_Contig2816 gSNP05385 CTTTGTTTCGCAATTGGGTT AGGAGCAAAAAGGAGGGAAG 373 BY878371 FY227220
CJ051109_Contig2819 gSNP05386 TTCTGGGCAATTTTTGGAAG TATCCCAGCATTGTTCACCA 436 BY878381 BY887954
CJ051109_Contig2821 gSNP05387 CCTTCAAATTCGAAATCCAGA ACTAATGATGGCCGCACAGT 408 BY878384 FY234426
CJ051109_Contig2855 gSNP05399 CAGAGACCGCCTCCTGATAC TTGCTAAAGTGAAGCTCCTGAA 471 BY896308 BY891078 BY878490 FY229295
CJ051109_Contig2857 gSNP05400 ATACGAGTCGAAATGGCTGC AGTATTCGACCCGTCCTCCT 526 BY878494 BY888143 BJ938322 BJ938325 BJ937854
CJ051109_Contig2867 gSNP05405 TCACGGTTTCAAATCTGTCG CGGCCACATTTCTCAAAGAT 457 BY878523 BY891851
CJ051109_Contig2871 gSNP05407 CGCAAAAAGATTGCTGTTCA GTCCAGGAGGCAAATAACCA 547 BY882106 BY878528 FY235101 FY228461 BY886694 BY894486 BY893273
CJ051109_Contig2883 gSNP05410 ATTTCTGAGGTTGGTGCAGG CTTGTCCGCAGTAACAGCAA 462 BY878575 FY228462
CJ051109_Contig2884 gSNP05411 CCAATTGTTAGACAGTTTGGATAA CACGCAAACCGAGAAGGT 482 BY878576 BY888870
CJ051109_Contig2890 gSNP05413 TGCAAGTTTTGTTTTCTTCCC CTGCCAGAATGCTGAATGAA 481 BY878597 BY890794 BY888158
CJ051109_Contig2893 gSNP05415 TTCCAGCTGTTCTGGTTCCT GCTGTGATCGTCAGCCATAA 437 BY878611 BY888398
CJ051109_Contig2898 gSNP05417 TCTCTCTGGTTGAGGGGAAA CTGCTCCACAAACTTCACGA 485 BY878631 BY886456 BY882238 BY879795
CJ051109_Contig2899 gSNP05418 AAGTTTGGACATGGCTGCTT ACTGTATGACCTTGCCGGAC 333 BP175959 BY878637
CJ051109_Contig2905 gSNP05421 CATTTGGCTTCGAAATTGCT CCCAACTTGGTTTTTAGGCA 495 BY878649 BY888420 BY892793 BP176489 BY886151 BY894901 FY231664
CJ051109_Contig2912 gSNP05426 GGCGGTGCAAACGTAATAAT ATTCACTTGCCGGTTTCTTG 453 BY893919 BY878672 BJ939301
CJ051109_Contig2923 gSNP05430 GGTGGCGAAGGATCAGATAA ACTGGAACTTGCTGGCAGAC 350 BY878700 BY895147 BY879889
CJ051109_Contig2924 gSNP05431 CTTCATGTGAGTAAGAGGGGG AGAGACTGGTGGCTGCAGTT 451 BY878701 FY232602
CJ051109_Contig2927 gSNP05432 AAACAGTGGAGAAAGGCCAA GCAGGGCGTAAGATAGGGAT 423 BY878708 FY235247
CJ051109_Contig2930 gSNP05433 TGTTCTAGCTCTGTTCGCCA AGGCCGGAGTAACAGTCGTA 423 BY892724 BY878714
CJ051109_Contig2932 gSNP05434 AGTTTTCATTGGCACCTTCG TGTGCAGTGAATTGTCCTTGA 336 BY878719 FY232925
CJ051109_Contig2934 gSNP05435 AACCTCTCTGCATTGCCTGT CATACACGAAGCCGCACA 506 BY878722 FY231914 BY891540
CJ051109_Contig2935 gSNP05436 ACAAGAAAGAAGCAGGGCAA CCAACATAATCATGCTCCCC 469 BY890311 BY878724 BY879959
CJ051109_Contig2936 gSNP05437 TATTTCTTGCATGGTGGCAA TGTTATTCGGACCGTGGTTT 501 BY884223 BY878725 BY878783 BY890596 BY891437
CJ051109_Contig2941 gSNP05438 TAATGGGGCAAAGTAAAGAGC CATGGCCGGAAGAAGATA 425 BY885332 BY878740
CJ051109_Contig2946 gSNP05441 TTCATGGATTTACCAGAAGCC AGGGAGGGTCTGGGAGTATG 430 BY878760 BY884138
CJ051109_Contig2956 gSNP05445 AGGTGGGGTGTGGGTTTAAT TTTGGGTACCGATCTTCAGG 509 BY887128 BY878789 BY885200 BY889821 BY878746 BY893472 BY893999 BY890637 AU299540
CJ051109_Contig2961 gSNP05447 CTCCCGAGACAAGCAAACAT TCCTCCACACTTGAGCTGC 407 BY878796 BY893975
CJ051109_Contig2964 gSNP05450 AAGAGGCCTTCAGTCCTTCC CTACAGCGACTGCCGATTCT 413 DC430656 BY878805
CJ051109_Contig2980 gSNP05456 TACCGAGTAAGCAACGAGGG TTACTTCAATGTCTTCTGTCACCTG 436 BY878857 FY227499 BY885019
CJ051109_Contig2989 gSNP05461 GAAGCTGAGGAGACTGGTGG GAGTCCAGTGGCCATACAGG 508 BY878884 FY226870 BJ937342
CJ051109_Contig2993 gSNP05463 CCTGTTTCTGCCTCTACCCA CAGGTAATCATCACTCATGTAAGTTTT 402 BY878888 FY233376
CJ051109_Contig2997 gSNP05465 CTGCTTTGTGAGTTCAGCCA GCCCAAAGCTTGGAACACTA 462 BY884704 BY878894
CJ051109_Contig3009 gSNP05470 TTTTTGCCCATGTCAATCCT TGTGCAACCACAAGCTCATT 508 BY885748 BY878923 BY879455 BY895728
CJ051109_Contig3011 gSNP05471 TTGCATGCTCTTTCTCAAGC CACTTCGAGGTCATGGTGAA 490 BY893550 BY892091 BY878927
CJ051109_Contig3015 gSNP05473 GCAACAGGAGTGTCAGATAGGG ACGACAGCCCTCTTGCTAAA 437 BY880995 BY878937
CJ051109_Contig3022 gSNP05475 AAGGAAATCAAAAGATGGCAG AGGCTTGGGGAAAGGATATG 482 BY894734 BY878948 BY893252 BY891049
CJ051109_Contig3024 gSNP05477 TTCTTCATCCCTGCAACAAA AATTCGAGTATCCACGGGGT 441 FY236003 BY878954 FY233404
CJ051109_Contig3037 gSNP05483 GGTGTTGTTCTAATATTGGGATAGAG GTTGGGGTAATGGACCACTG 471 BY879003 FY232795
CJ051109_Contig3051 gSNP05490 TTCATTCATTCCTCACGCAA ACCGGAATAACATCTCCACG 551 BY893302 BY882560 BY879054 AU084474 DC430533 BY881201 BY881293 BY890299
CJ051109_Contig3060 gSNP05495 TTTTGTCTATTTGGGGTCGC TTGTCAAACAATTCTCCCCC 532 BY891954 BY879076 BY886230 FY227172
CJ051109_Contig3062 gSNP05497 TTTCTTCCAACCCTCCTCCT TCCAGCAGCAAATCCCTTAT 519 BY879210 BY879081 BY887556 BY895896 BY890036
CJ051109_Contig3071 gSNP05500 TCCCAGCTATCCTATGGTGC AACCTTGTGCCTGGAGAGAA 528 BB940715 BY883073 BY879107 FY233786 BY884564 FY226189
CJ051109_Contig3082 gSNP05504 CTTAAAAAGTGCAAAATTTGTTCG TCAAAAGCTACACCTTCCTCG 400 BY879129 FY231847
CJ051109_Contig3083 gSNP05505 GCTGAAAGCCCTCCTGAGTA ACTTCGCGAGCATTACCACT 539 BY892181 BY891499 BY879132
CJ051109_Contig3101 gSNP05509 TAAAGGACGGTATTGCCACC AACCCATTGGTGGTATAAATGC 423 BY879466 BY879204
CJ051109_Contig3103 gSNP05510 TTCCTGCTGAAGGGTCTGAT CAGAGCAGCCCCAACATTAC 467 BY879215 BY879960
CJ051109_Contig3105 gSNP05511 GGTACCATTTCACGGCAATC TCTTGATACGCTGGAGCCTT 544 BY887890 BY886598 BY884216 AU298984 BY893867 BY886718 BY895040 BJ939724 BY879218 BY895710 BY890038
DC430179 BJ937013 BJ940195 FY226413 FY231730 FY234571 FY228100 FY230776 FY230930 FY234625 FY236672
BY894182 BJ937309 BJ937011
CJ051109_Contig3107 gSNP05512 AAAATGGCAAGAGATAAGGTTCA CGAACTCCATTTGACAACGA 350 BB941504 BB941345 BY879222
CJ051109_Contig3108 gSNP05513 TGCTTTTTCTTGGCCTTTTC CCAACACTGATTTGGAAGGA 440 BY879224 BY891494
CJ051109_Contig3121 gSNP05521 TGTTCCTCCCAATCACAACA GCGATAATTAGGGCCATTGA 478 FY229269 BY892518 BY879275
CJ051109_Contig3145 gSNP05529 CAGCTGAAATTGTATATGGGAAA GAGCAACTGAACTGTATCAACAA 309 BY887718 BY879355
CJ051109_Contig3146 gSNP05530 GAAGTCTGGAGTCTTTGGAAGG GGAGGGAACGTTCATGTGTT 313 BY879358 BY878842
CJ051109_Contig3147 gSNP05531 GATCTCACTGCCAAGGTTCC GTGTCCCACAGAGGCTGATT 443 BY879361 BY883779 BY896781 BY878562 BY889569
CJ051109_Contig3154 gSNP05534 GAAGCAGATTGGCACACAGA GCAACAATAGCATATGCCCC 394 BY879383 BY884611
CJ051109_Contig3158 gSNP05537 TGTTCTTCCTTGCTCTTTTCG GACCAAAGCAAATTCCGAGA 420 BY888161 BY881949 BY879406 BY891811
CJ051109_Contig3163 gSNP05538 TCCAGTTATGGAGTCTCCCG CCGCAGGTCCAATGAATAAC 536 BY879417 BY895051 BY894253
CJ051109_Contig3166 gSNP05539 TGACTCTGACCCTTTCTGGG GCACGCAGTGAAAACAATGA 523 BY879445 BY887165 FY232228
CJ051109_Contig3167 gSNP05540 ATTGGTATCAGAGCCGATGG TGGTAACAAAATTGGGCGAT 462 BY879447 BY896007
CJ051109_Contig3169 gSNP05541 CGAGCTTATGCTGGTCACAA TGATAAACCTCCTGCTGGCT 552 AU084256 BY879460 BY878156 BY890831 FY230559 FY228682 BY888885 FY234063
CJ051109_Contig3178 gSNP05543 TTGATCTGCCCAACAAAATCT TGTACCCACTTTCCTGCTGA 371 BY879490 BY889338
CJ051109_Contig3198 gSNP05549 CGGAGTGAAAACCAAAGGAA CTGTTTGTGGATCGAAGGCT 483 BY895924 BY889466 BY886553 BY883263 BY879541 BY886569 BY895788
CJ051109_Contig3206 gSNP05552 TGTCATGTTTTCTGGGAGCA TAGAGCCAGCGCTCTTACCT 493 BY879555 BY880418
CJ051109_Contig3217 gSNP05557 GCCACACATTTCCTTCTTGT TGAGAATGGAGAATACTGTGGGT 412 BY879589 FY226730
CJ051109_Contig3233 gSNP05563 TTTTTGAGACCGAGTCTGCC GGCCTCAAGAGAATCCAAAC 519 BY883118 BY879629 FY226222 BY886537
CJ051109_Contig3248 gSNP05569 CAGCAAGATGGTTGGGTCTT GCATACGGATGATTTCAGAGC 473 BY881212 BY881350 BY879675 FY228006 BY895251
CJ051109_Contig3249 gSNP05570 GGGTAGAGAGGGAAGATCCG GGTTCGTAGCCTGAGGTGAA 336 FY233020 FY234261 BY879676
CJ051109_Contig3251 gSNP05572 TGCGATGGAGGGAAACTTAC CGGACGTGGATGAAAAATCT 490 BY891175 BY884866 BY893846 BY879691
CJ051109_Contig3253 gSNP05574 AGCGTTTGGAAGGAGGAAGT CAAGACAGGTCCTCCCAGAA 422 BY887354 BY887030 BY879696
CJ051109_Contig3259 gSNP05576 TAGGGTTTCGAATCACTGGG AACCCTTCGAGAGCCTTCAG 549 BY879712 AU084078 FY229074 BY890862 FY231209 BJ937557
CJ051109_Contig3261 gSNP05577 CCGTATGAGCAGGCAGAGAT CCTCAGACTCTGCCAGGAAC 459 BY879716 FY228218 BY890846 FY231239
CJ051109_Contig3272 gSNP05585 TCAGAGAATCCTGTAGTTAAGATTTTT CCAGCATATCATATCATGCAA 505 BY879755 BY880371
CJ051109_Contig3277 gSNP05588 TGCATTTACATTTTTCCCGA TGATCCTCACAGCACTGGAA 451 BY879778 BY885940
CJ051109_Contig3287 gSNP05593 CGAGGTGGTTAGTCCCTTCA GGTTGTCTGCTCTGGTCACA 458 BY879817 FY233869
CJ051109_Contig3302 gSNP05600 TGTGCTTCACTGAATGAATGG GGGGCCTCTGGTTTAAGAAG 453 BY879867 BY893140
CJ051109_Contig3305 gSNP05603 TCCTGCAATGGGTCACTGTA CCGCAGTGTGTTAGTCGAAA 464 BY877970 BY885089 BY879872
CJ051109_Contig3311 gSNP05606 TCAAAACAAAAGTGGCTCTGC ATGGCCAAAACTCTTTGGTG 470 BY881570 BY884603 BY895420 BY893793 BY879884 BY891186 BY890243 FY229076 BY893442
CJ051109_Contig3318 gSNP05609 ACCCAGAGTCCTGCGATTTA CAGAGCTTTCGAATCCTTGC 439 BY886893 BY879904
CJ051109_Contig3320 gSNP05610 TCGGAGCCTCTGTCTTCTTC GCAAAAATGCTGAAAGGAGC 503 BY879913 BY896244
CJ051109_Contig3330 gSNP05612 GTTGTGTCCCCCTTGGATTA CCAATGTTTGAAGAAAAGCCA 536 BB940744 BY879939 BY894469 BY880340 FY231861 FY226947
CJ051109_Contig3335 gSNP05615 TTCCATTCCAATTGTTCCGT TGACGTGAAAACCCTCATCA 538 BP176582 BY879951 FY231788 BJ937839
CJ051109_Contig3340 gSNP05616 ATTGACTCGTCAAAAACGCC CCAGATTGTGTGAGCTCCTCT 500 BY879966 BY890920 BY887119
CJ051109_Contig3352 gSNP05620 TAATCCAAGGCAACCTCGAC AACCTTGGGACATCGTGAAG 571 BY880010 BY889613 BY889221 BY890841 FY232456
CJ051109_Contig3362 gSNP05626 GGCTCGTGGGATTCTTAGAG GGTAAGCACCACCCTTTTCA 435 BY880049 BY880501 BY896287 BY884482 BY885208
CJ051109_Contig3376 gSNP05631 TTTGCGCAACTGTTTTAGGA TGCTGAAGATGAACTCGGAA 456 BP176461 BY880082 BY886042 FY229384 BY878899 BY895831
CJ051109_Contig3380 gSNP05634 TATAACGCGGCAGCTCAAG CCCTTGATGAAGCCAACAAT 506 BY880087 FY227019 BY880022
CJ051109_Contig3386 gSNP05637 CCAATGTTGCAGCCCTTAGT GCAGCAACCATGGAAGACTC 506 BY881081 BY885321 BY880105 FY232236 FY227513 BY893500 FY233498
CJ051109_Contig3392 gSNP05638 CTGTAAACCAATGGCGACCT CCATCCGTCCTGTCTTTCAT 498 BY880121 FY226788
CJ051109_Contig3394 gSNP05639 AGAGGGGATATGGATGGAGG AGCTGAAGTCTTTCACCCGA 475 BY883795 BY881592 BY888076 BY880124 FY232112 FY231671 FY232528 FY236246 FY235302 BY892747 FY231210
CJ051109_Contig3399 gSNP05643 AGCGCCAGTCTGTGAAGAAT TAGGGAATGCCCATAAATCG 441 BY880134 FY229092
CJ051109_Contig3402 gSNP05644 AGCAGGTGGAGAAACCTGTG CCCAAACTCCGATCAGAAAA 547 BY880142 BY879989 FY230987
CJ051109_Contig3410 gSNP05646 CTGGCCAGCAATCAGAATTT ATCAGCAACCTGTCCTCCAC 453 BY893298 BY880199 BY885353 BY880162 BY880195
CJ051109_Contig3415 gSNP05648 GCTGTTGGGCTGAAGAAATC TTGTCACCAAGGGAAAGTCC 509 BY889459 BY894621 BY878288 BY879534 BY880174 FY229050 BY888069 FY226667 BW996720 BY889118
CJ051109_Contig3417 gSNP05649 CAGCCATAGCAGCACATTCA GAAATCCGGAGAATTCAGCA 480 BY882924 BY893097 BY887124 BY891303 BY880181 BY895165 BY886310 FY226146 FY228132 BY891758 BY879270
CJ051109_Contig3419 gSNP05650 TCCTGGTTGTGGTGAGATTG AGAGGAGGAACCTGAACCGT 400 BY880185 BY885133
CJ051109_Contig3421 gSNP05652 TCAATGGCGTACTTGTGGAA CATGGCTCCTGTTGTGCTAA 431 BY881826 BY885520 BY880189 FY227888
CJ051109_Contig3423 gSNP05653 CAAGTGGTTTCAAAGGGCAT CCCAATCCATGTCCTAAACC 493 BY880192 BY890670
CJ051109_Contig3428 gSNP05656 TTCGATTCTGCTGATCTTGA GCAGAGAAGCCAAAGGAAAG 438 BY880211 BY893030
CJ051109_Contig3433 gSNP05659 GGGTTGTGGTGGTCTGTTCT AGGATTTTCCGATTTCACAA 426 BY892918 BY880228
CJ051109_Contig3448 gSNP05667 GCAATAATGTCCGCACTCAA GGAATTCGACCACATGATCC 515 BY885529 BY886218 BY880270 BY891738 FY233275 FY229598 FY231438 BY882652 FY236502 FY229199 BY892939
CJ051109_Contig3449 gSNP05668 TCCTGCGTTCCTACATTTGG TTCAGCATCTGCTTTATGCG 440 BY885827 BY880272
CJ051109_Contig3450 gSNP05669 ACATGAAGGCCATAAGCTCG CTTTGATGGTGGCTTCCAAT 441 BY880274 BY880603
CJ051109_Contig3451 gSNP05670 AACTTCTGCTGCTCTTTTGTGTC GATCAAAGATTGGAGTGGGC 429 BY882390 BY881974 BY886921 BY880277 BY894349 FY227263
CJ051109_Contig3453 gSNP05671 TCATCCGATCTGTCATCAGC TCGCCATTTCCATTCTTTTC 529 BY891184 BY884401 BY880281 BY880496
CJ051109_Contig3460 gSNP05674 CTTCTTCTGTGCAATGGCTG GGGTACTTGAATCACCGTGC 459 BY892197 BY882582 BY880313 BY887254 FY234826 FY227174 FY229440 BY887448
CJ051109_Contig3462 gSNP05675 TGTATGCATTGGCTTTGAAGA GCAATGAAATCATTCGTCCC 517 BY887607 BJ938616 BY880318 BJ937578
CJ051109_Contig3465 gSNP05677 AGATGGCTGAAAAGCTTGGA TGTCTTGGGATCTACTCCCG 469 BY889264 BY880325 BY880621
CJ051109_Contig3467 gSNP05679 TGTCATCTGGGTCGCTTTTT TACCCCAAGAGCACTTACCG 518 BY880328 BY895425 FY232359
CJ051109_Contig3479 gSNP05684 TGCAGTCATGGGTAGAGGTG ATCCAGGCTTTTCTGGTCAA 487 BY889609 BY880363 BY889291 BY881893 BY890176 BY893908 FY226515 FY225510 FY236288
CJ051109_Contig3480 gSNP05685 AGCGACAGAGAGGAAATGGA GCTGAACCCTCTCTTCATCG 314 BY880365 FY228240
CJ051109_Contig3485 gSNP05687 TCAGAATGGCTGCTCACATC ATTCACAGGATATTTGGGCG 480 BY881440 BY880378 BY883881
CJ051109_Contig3488 gSNP05689 ACGGACTCCAGAAACCACAC ATCCTCCCCTTCTTTCTCCA 527 BY882861 BY883177 BY890034 BY880383 FY228415 FY230152
CJ051109_Contig3491 gSNP05691 AGGAAACATTTTCTCTCTGTTGA AATAGGCCCAGGTATTCAGC 445 BY880391 BY893167
CJ051109_Contig3493 gSNP05693 CAGATTGTGAGCAAATCGGA GAGCTAGTGCCAATGACGGT 442 BY880395 BY889908 FY229848
CJ051109_Contig3499 gSNP05694 GGCTGCTGTGTGATTTTCAG TTTGTGAGCAAATCAATCGC 536 BY880414 BY886231 BY885769 BY894852 BY894098 FY230021
CJ051109_Contig3502 gSNP05695 CTTGATTTCTGTGATCAATGGTT TTCCTTCCCCAATCACCA 410 BP176031 BY880426
CJ051109_Contig3510 gSNP05702 CACAAAGTTTTGGGGCAATC GGGTGGAATGGAATATCAGG 469 BY880448 BY894029
CJ051109_Contig3511 gSNP05703 TAATGGCTGGAGTGCAAAAG CCAAAGCCAAAGAATTGTCC 475 BY882376 BY888941 BY880452 FY234749 FY232669 FY233260 FY233928 BY881360 AU299259
CJ051109_Contig3512 gSNP05704 AGGCCAATCAAGCTCTCAAA CGGCCTTGACGACTGTATCT 540 BY880454 FY225770 AU085168
CJ051109_Contig3513 gSNP05705 TAGGGGGAGATTCAGAGGGT GCTCAAACAGATCGGTGACA 506 BY881341 BY880461 BY891947 BY890868 BY887088
CJ051109_Contig3516 gSNP05706 TTTATCTCGCCGTCGTATGG TCTTGAAAATGCCGATGGTT 507 BY880465 FY228804 DC431368 DC430619 BY895345
CJ051109_Contig3520 gSNP05708 GTTGCCCGTTACAAACCAAG ATTGGGGACAAGGACAACAG 536 BY880477 FY229761 FY228319
CJ051109_Contig3525 gSNP05709 TGTCTGTTTTGCAAGTTGGG CGAGACTGGAAGAGAGCCAC 514 BY880494 FY228422 FY227688 FY226733 BY896628
CJ051109_Contig3533 gSNP05710 AGCCATGGACATGGTTTTGT TGCTCCCCATCTAGCTAAAAA 597 BY880517 FY230944 BY893243 FY232890
CJ051109_Contig3547 gSNP05715 CCGTTTCTGTTGGGAGCTAT CTTCAACTTTTGGAGCACCC 456 AU083983 AU084653 BY880564
CJ051109_Contig3552 gSNP05718 TGTCTGTGTCCTGTGCTGTG GCATTGCAAGGTTCAGTCCT 474 BY880590 FY231129
CJ051109_Contig3560 gSNP05722 TGAAAAGGTGTGATTTTTGCG ACTGTTCATGGTTGTTTGCG 417 BY880615 FY235640
CJ051109_Contig3567 gSNP05723 GCGTTTGAAAAGCGTTTAGC TGCTTGAGTTCAGAGACTTTGC 502 BY880628 FY226041 FY236462
CJ051109_Contig3568 gSNP05724 ACATAAGGGCTTCACGTCCC CCCAGATAGGAATCTGCAACA 508 BY880631 BY896392 FY229381
CJ051109_Contig3589 gSNP05732 CTCGTCGCCGAAGCTATG AAATAATAGCTTTTGGGTAGCCATT 419 BY880711 FY226969
CJ051109_Contig3601 gSNP05739 TCTGCTTAGGGGAACAGGAA GCAGAGACATCCCCTCTCAG 404 BY880750 BY882800
CJ051109_Contig3613 gSNP05744 CCTAATGTCACAGCCATTTTTG GCTTATAAAAGAGGAGAGCCCC 478 BY880780 FY228439
CJ051109_Contig3616 gSNP05745 GCAGCTGGATTTCTATTGCC TTGTGGATGGGACAACAATG 511 BY886633 BY880797 FY229194
CJ051109_Contig3621 gSNP05747 AGCCGTCTTTCAGGGTTTTT CAACAATCCGCAAAATCTCA 510 BY880809 FY229621 BY883995 BY883251
CJ051109_Contig3622 gSNP05748 AAATTTTCGCGCATAGTTTGA GCCGGTTTCTTCTTCTCTCC 448 BJ937721 BJ939284 BY880815
CJ051109_Contig3642 gSNP05751 GCCGTGTTTTCCTAATCCAA AAGCCCTCTGTTTTGGGTAGA 504 BY880883 AU084275 BY887442 BY893947 BY889204 BY885681
CJ051109_Contig3646 gSNP05753 TGCACCACTTGGATCTACCA GCTAGAATCCCTTGTGCCAG 508 BY880900 FY228872 AU299490
CJ051109_Contig3658 gSNP05756 GCCACCGTACAATGTTTGAA TACACGCACCACCACAAACT 558 BY880936 BY890668 FY230194
CJ051109_Contig3663 gSNP05759 CACACAGAAGTTAGGGTGCC ATTAATCCCGAAGGCAGGTG 424 BY896668 BY880951
CJ051109_Contig3667 gSNP05760 GTGAGGGGGAAGTTTTTGGT CCCGAGATAAGACGTCAAGC 501 BY880964 BY893156 BY889588 BY894539
CJ051109_Contig3672 gSNP05761 ATGCGTGAATAAAACGGAGG GCAAGAACCCAAACCTTGAA 471 BY880975 BY895760 BY896212
CJ051109_Contig3684 gSNP05767 GGAAGTGAAGAAAATGGCGA CCAAATAAAACCCATCGTCG 461 BY878313 BY885253 BY881013 FY227036
CJ051109_Contig3690 gSNP05770 TTTTGGGGCTGATTTTTGAC CATCCCCTTTTGAACCTGAA 464 BY881028 BY885100 BY889128 FY231771
CJ051109_Contig3693 gSNP05772 TTGTTTGTTCCCCAAAATCC GAAGCAGAAATTGGGTCTCG 455 BY895598 BY881481 BY881047 FY227461
CJ051109_Contig3695 gSNP05773 CTATCAACACCCGTCGCTTT GAGCAGGAACCCCAAAACTA 428 BY887601 BY895526 BY884504 BY881058 BY880366 FY225999
CJ051109_Contig3700 gSNP05776 GTGAACGCGTTTTGGCTAAT TCTGGATAGCAAGGAAGTTGG 323 BY891685 BY881071
CJ051109_Contig3724 gSNP05782 CAGGTCGTCTCAGTCTGCAA CAAAATTGTGCGATCCATTG 577 BY881145 FY232310 BY891894 BY889194 AU084704
CJ051109_Contig3728 gSNP05784 AAGAGCCAGAAGAACCCCTC CCCTCGATCTCCATGAAAAA 404 BY881164 BY893733
CJ051109_Contig3769 gSNP05792 CATGCTCCAGCACTGTGAAT CAACTTTGTGTGCCATTTTCA 452 BY881299 FY227396
CJ051109_Contig3770 gSNP05793 GTCCGGTCAAAGTGAAAAGC ACCTAGGCCAAGTTGAAAGC 346 BY881301 BW992316 FY231267
CJ051109_Contig3780 gSNP05797 TGGATTTGTTTAATGTGTTGGTG TGTGCAATCTCATTCTCCCA 457 BY884896 BY881331 BY893764 FY236046 BY892845
CJ051109_Contig3784 gSNP05798 TTCCAAGCTGTGAAATGTGC TACCAAGCGAAGTTCTCCGT 559 BY882592 BY881340 BY892358 FY232688 BY893705 BY894441
CJ051109_Contig3785 gSNP05799 AAAATCCTGCGAGTGGAAGA GACCTCCATGGCAACACAC 316 BY881342 BY896554
CJ051109_Contig3793 gSNP05802 CCTTTGCGCCTTTTTATCAG GCTCCAGGCATCTTTGTCTT 575 BY882727 BY883036 BY881374 BY884290 BY887975 BY896787 BY890591 FY228437
CJ051109_Contig3797 gSNP05805 GCCGCAGAGAAAAGAAATTG TGCGAGTGGTTGAGGTGATA 418 BY881387 BY890575
CJ051109_Contig3821 gSNP05810 GGGCTGATTTTTGAGCACAT ATTAGCGTCGCCAGTGTTG 502 BY881503 BY885067 BY888124 BY892117 BY888275
CJ051109_Contig3832 gSNP05812 TCGCAAGGGTAGTTTTGTTTC GTAAGTTTGATCGGGGCTGA 413 BY882977 BY881536 BY883805
CJ051109_Contig3836 gSNP05814 TTGTGGATATCACAGCCTTCA TGTTCCAGACCTATCACAATCAG 465 BY881548 BY885391
CJ051109_Contig3838 gSNP05815 GAGGTGGCGGATTCCATTAT AGAAGTCTGCCCACCATGAG 459 BY884998 BY881560
CJ051109_Contig3843 gSNP05819 ATAAAGCCGGAGGTGGATCT CAGATGAAGGAATGGAGGGA 492 BY881578 BY879145 BY887338 BW993095
CJ051109_Contig3846 gSNP05821 CTGCGTGTCTGAGAGTGCAT CGTATGATCTGCTTTGCAGG 520 BY881582 FY232501 FY226195
CJ051109_Contig3850 gSNP05822 CGCACGAATAGATATGGCAA ACCGATACAATTGGGCAGAG 501 BY881593 BY883088 BW993633 AU084531 BY882994 FY228960 BY878870
CJ051109_Contig3853 gSNP05824 TGTAGTCCATGGGGTTCTCC GAACCAGAATAGCCCCTTCC 503 BY891322 BY881598 BY880188 BY887808 BY891451 FY231801
CJ051109_Contig3855 gSNP05825 TGTGGAATTGGTAGTCAGCG AAAGTCCTGCACATTCCTGG 529 BY881601 DC432325 BY892037 BY896528 FY229539 AU299228
CJ051109_Contig3858 gSNP05826 GGGTTGGTTTTGTCCTGC CCAGACATAATTTCTCAAATATCCTC 434 BY881619 BY884349
CJ051109_Contig3866 gSNP05830 TAGACGACATGGATCCCTCGAT GGTCCAGCCTGGGACTTCTA 448 BY881640 BY893772 FY226161
CJ051109_Contig3869 gSNP05832 AAGATTTGGAGAAGGAGGTTGA CCAATTTCAGAATCTCCGTCA 445 BY881650 BY890673
CJ051109_Contig3874 gSNP05835 TATGCCCCCTACAATTGCTT GCATTGCAACAAATAATCAACA 431 BY881892 BY884878 BY881661
CJ051109_Contig3875 gSNP05836 GTAGTTGCAAAATAGCCGTGC ACACCATGGCCAGCAAAT 476 BY889428 BY881662 BY882130 BY893517 FY229324
CJ051109_Contig3877 gSNP05837 GCTCTAGGCTTTATCGTCATTCA TGAAGTCCCTCATCTGACCTC 334 BY882153 BY881667
CJ051109_Contig3880 gSNP05838 CCCCTTTGTGTTCAAGTTCC ATTTCCAGTCCGATCAATGG 385 AU085057 BY881671
CJ051109_Contig3884 gSNP05839 GGCTAGCATTGTGGCAAGAT GGTTTTTGATTCAATGCCGT 478 BY881699 BY895993
CJ051109_Contig3887 gSNP05842 AAGGTTTGGAGAAGGAAACCA GACCCAATCAGGGTTCTTGA 469 BY881717 BY881060
CJ051109_Contig3902 gSNP05845 GCGACGATGAAAAGAATGGT GCTTCAATTCAACATTGTAAGTCTTC 403 AU084625 BY881776 BY878185
CJ051109_Contig3903 gSNP05846 AAAATTGACGGAAGCAATGG CGACCTTTCCTTTACCCACA 549 BY881948 BY881777 DC430990 FY229414 BY894378 BY892675 BY878318 BY880230
CJ051109_Contig3908 gSNP05848 ACAAGATGGGTTGTTCGGAG ACGAAAATGGCCTTCAACAC 313 BY885627 BY881801
CJ051109_Contig3911 gSNP05850 GCACAACATTTGCCCATACA AGCCCTTTGTGTTCCAGAGA 522 BY881810 BY885383 FY229608 FY227486 FY232176 FY225776 BY889620
CJ051109_Contig3922 gSNP05857 GGAGATGCCCGAATGTTCTA CAACCGTCAGAAACCCAATAA 479 BY881846 BY895505 BY880024 BY889748 BY888111
CJ051109_Contig3934 gSNP05862 CAGGCACCCAAACAAAATCT ACTGATCATTGGGCTTGTCC 463 BY881898 BY889050
CJ051109_Contig3935 gSNP05863 GCGTGCATATGTTTTTCTGC CCGCATCTGCAAGGATATAGA 459 BY881899 FY232127
CJ051109_Contig3939 gSNP05865 GCCAAAAAGCTTAAAGAGGG TTCCCCAAACATCTGCAATC 427 BY893538 BY881916 AU083945 BY895367
CJ051109_Contig3944 gSNP05867 AGCCCCAGGGTCGAATAC GCCGGAGAATTTAGGGTTTG 479 BY881933 FY227652 FY226822
CJ051109_Contig3952 gSNP05870 CTCGGAAGGAGATGAAATCG CGCAATTTCGGATTATCGAC 445 BY881969 BY894244 BY884339 BY885140
CJ051109_Contig3955 gSNP05871 GAATGACTCATGTGCTCCCC CATGAGGCTGCTGATCTCAC 430 BY881983 BY888387
CJ051109_Contig3956 gSNP05872 GCCCAAACCAGTCGATTAGA ATGATTCCGATGTCAGAGCC 515 BY896755 BY887145 BY881985 BY894462 BY885539 BY894132 FY226131 FY226771 BY892356 FY227732 FY226541
BY889113
CJ051109_Contig3985 gSNP05876 AAGAGATGTCCAGGAAGCCA TCCAATCCCTGCATTGAGAT 505 BY888390 BY882097 FY226160 FY234666 BY887867
CJ051109_Contig3986 gSNP05877 TCCACAAGGACTCTGAGAACAG TGCATTTTGTACCTCTGTGGA 349 DC431941 BY882100 BY890404
CJ051109_Contig3987 gSNP05878 ATGGCGAATACTCTGCTGCT GACGCCATCTCCAGACAAAT 546 BY882111 FY234657 BY887417
CJ051109_Contig3988 gSNP05879 TCATTGGCCAAAGCTTCTCT GAATCGAGTTAGGGTGGCAG 477 BY886792 BY882116 BY885215 BY880014
CJ051109_Contig3993 gSNP05881 GTTGTAGGGCCTCTGTTGGA CACAAGAACCTCCCCGTAGA 596 BY882133 FY232025 FY231828 BY889603
CJ051109_Contig3997 gSNP05882 CGCGGATCTTAAATTCGGA TCAAATTCAAACCCTAACAAACC 429 BY882156 FY231629
CJ051109_Contig4011 gSNP05884 GAAAATGGAGGGAATTGCTG AAGGCTTAAAACCCTCAAATCA 499 BY882198 BY879342 BY886925
CJ051109_Contig4015 gSNP05887 TTCGAATGGCATAAAGGACC CCCTCCAAAGCAAACGATAA 460 BY882209 BY890720 FY227910 FY227069 BY893203
CJ051109_Contig4036 gSNP05896 AAGTAGGTCAGGCTCAGGGC TGGCAAGGTTAGGGTAATTCA 378 BY882926 BY882283
CJ051109_Contig4042 gSNP05897 GGCAGAGAAAGCAACGAAAG ACTCGATCATTTACCGTGGC 549 BY881162 BY882307 BY889627 BY878410 FY225898
CJ051109_Contig4049 gSNP05898 AAGCTGGCTGTTGGAGAATC TTGTGCAATTTCACCTCCAA 314 BY891940 BY882331 BY881411
CJ051109_Contig4052 gSNP05900 CACTCAGCCTTGAATCCACA CATGACCATGAAGCGAAGAG 458 BY882339 FY236115 BY893875
CJ051109_Contig4055 gSNP05901 CAATTAAGAATAACAACAGCCTTTTT ATCCGGTGAAAAGCAAAGC 504 BY882348 BY894328 FY230567
CJ051109_Contig4060 gSNP05903 CAAGATGCATTCATTGAGCG AGCTCCCCACAGTCTTTGAA 453 BY882374 BY882767 BY896473
CJ051109_Contig4075 gSNP05908 TGCGATTCTTTCCTTTTGGA CAGGCCTCTCAATTGCATTC 331 BY882422 BY883834
CJ051109_Contig4076 gSNP05909 TGGAAATTCAGCATTCACCAT CAAGCCAATGGCAGATACAA 515 BY882424 BY886070 FY232429 AU299072
CJ051109_Contig4091 gSNP05913 AAGTAGGCCATTGTTGGTGG GCCATGGTAAGGAGCAAAAA 576 BY882473 BY892473 AU298809
CJ051109_Contig4093 gSNP05914 CTGGAAAAACCAGACTTGGC GAAGTGTTGGCCTCGTTCTC 367 BY884403 BY882476
CJ051109_Contig4099 gSNP05918 GCAAAAATGACAGGTCACGA GGTCCATCAAGCACCTTCTG 511 BY882495 FY225485 FY234831 FY231007 FY227271 FY234302
CJ051109_Contig4102 gSNP05919 GATGGAAACAAATCATGGGG TTGCCACCTGGTTATTCCTC 515 BY882504 BY891597 BY894235
CJ051109_Contig4116 gSNP05925 GATGCTCCAGAGGATTCACC CAGGGCATATATGGAAAGCG 502 BY882566 FY231626 BY878872 FY225708
CJ051109_Contig4128 gSNP05930 TGAGGCATTGGAGGTTAGGT CCCACGCTGTATATGAATGC 501 BY882610 FY234082 BY884075
CJ051109_Contig4142 gSNP05935 CGCAGATTCATTTCGACTCA AACGACAGCCTGCATGAAT 554 BY882667 FY234779 FY234176
CJ051109_Contig4145 gSNP05937 GCATTTCTCCATGTTCGTCC CCAACTGAGTGAGATTGGCA 531 BY882680 FY227395 FY230537 FY233975 FY232113
CJ051109_Contig4166 gSNP05943 GTTCGAAGTTTGATTCGGGA AAAACATCTCCATTTGAAGTTTCTG 500 BY882760 BY880220 BY895606 DC432229 BW996787
CJ051109_Contig4174 gSNP05946 TTCAGAGGGAAAAATGACCG ATTAGGGTATCCATTCGGGC 463 BY884198 BY882781 BY878082 FY227504
CJ051109_Contig4176 gSNP05947 ACAGAATCCAGGCTTCAACG TCGACGAAACTACTCAAATAAACAA 442 BY885688 BY882784 FY228346
CJ051109_Contig4177 gSNP05948 AGGGGAGGGTTTCTAGGGTT ACGAAGTCCTTCACTGGCTG 537 BY882785 BW992664 BY891300 FY233061
CJ051109_Contig4184 gSNP05951 GCTTCTACCATGGCAGCTCT TGAGAGCCTGCCCAATAATC 478 BY882831 BY882804
CJ051109_Contig4190 gSNP05953 TGCAGTCTGATTACTGCCCTC CGCCATTCGTCTACAAAACA 487 BY882822 FY229855
CJ051109_Contig4197 gSNP05954 TGCGGCTTTTCTTACTTCGT TGCTTCCCCAAGACTAGCAT 487 BY882840 FY229469
CJ051109_Contig4217 gSNP05961 ATGGTAAAGGAGGGGGAAGA TCACATGAGGAAAGCGTTTG 369 BY882954 BY894591
CJ051109_Contig4228 gSNP05966 AAAATTCCTCAGGCTCCACA AGATGTGGAACCAAACCAGG 529 BY883003 FY234196 FY229274
CJ051109_Contig4232 gSNP05968 GAGCAGCCTTTCTCCATCTG AACCCCATCCCCTCAGTAAC 455 BY893495 BY883017
CJ051109_Contig4238 gSNP05971 CCAATGATCCATGGGCTATC AAGGCATCTCAATGGTCCAC 449 BY883055 BY895583 BY891177 FY232778
CJ051109_Contig4245 gSNP05975 TTGGATGTGTAATGGATGCC ATTAGAGCTTGGTCAAGGCG 464 BY883240 BY883071 FY227381
CJ051109_Contig4257 gSNP05980 TCTTTTTGCACACGGATTTG CAAGGCCAATAAAGGCATGT 543 BY883101 FY227761 FY230858 FY235108 BW992824 BY885413
CJ051109_Contig4280 gSNP05987 AGCTTCGGCCCATACTTCTT GCTCGTAAAGCTGACCATCC 408 BY883181 BY887477 DC432592
CJ051109_Contig4282 gSNP05988 TCGCATTTCATTGTAGCCTG TATCGCTGGGCTTCCATATC 383 BY883183 BY889384
CJ051109_Contig4283 gSNP05989 TGACTATTGGAATCGCAGGA TGAGGGATATGCATCGTCTG 447 BY883184 BY894553
CJ051109_Contig4290 gSNP05991 TCAGCTCTCCAAAGACAGCA GGCTTGTCATGCCTCTTTTC 444 BY889343 BY883218 FY233007 FY234599
CJ051109_Contig4318 gSNP06000 TGTCATGGCACTAATAATTAAACC CCTTATGCATTGTATGCTTCAAC 370 BY894680 BY883308
CJ051109_Contig4324 gSNP06003 CGACAAACCTGGAAGCATTT GCTCAAGATACCTGAGGGGA 418 BY883322 BY887233
CJ051109_Contig4326 gSNP06005 TTTTCAGGGTTTTAAGCCGC GCACTGAAAAACCTCGGAGT 347 BY883326 BY884155
CJ051109_Contig4327 gSNP06006 CGAAATTTCAGGAGGGCATA AACCCAAGCATCATTCCATC 577 BY883192 BY883330 BJ939782 BY880862 BY883315 BY883380 BY887774 BY895368 BY879994 BY892118 BY893413
FY229040 BW997070
CJ051109_Contig4329 gSNP06007 CCGTCTGAACAATAAACGCA GTCGCATCAACGAACTCAGA 525 BY883342 FY225548 BY879567 BY890166
CJ051109_Contig4331 gSNP06008 TGCAATGGAAAATCTCTGGA GTCTTTTGCAAGAATGGGGA 332 BY883347 BY888376
CJ051109_Contig4340 gSNP06011 GGGAGATTAGAGGCCGAGTT ATTCACCTCGGTGTCCTTCA 441 BY885470 BY883378 BY889921
CJ051109_Contig4343 gSNP06012 CCTGTGAGGGGATCTGTGTT CATAACGGAATCTGCCACCT 404 BY883386 BY894389
CJ051109_Contig4344 gSNP06013 AATTTGGTGCATTCATGACG TTCGCGAATTATACACAGCG 500 BY892580 BY883396 FY226887 BY882498 BY879537 FY226226 BY882353
CJ051109_Contig4345 gSNP06014 CAAATAAGAAATTTGCAACAATGG CCTCTTTCCAATCCCTCACA 389 BY889028 BY883401
CJ051109_Contig4349 gSNP06016 GTGCATTTGGGTATGCCTGT ATGGAAGATGAGTTCCAGCA 439 BY883427 BY893840
CJ051109_Contig4369 gSNP06020 TGCCGATGTTTATGTGGCTA CCAAGCCCTCCCTGAATTAT 538 BY883525 DC431842 BY881987 DC429830
CJ051109_Contig4374 gSNP06023 TCCAATCCAATGGAAAATGG AGGGAGCCTATATAACTTAACTTGGAA 420 BY883548 FY231522
CJ051109_Contig4375 gSNP06024 TTGTTGGGTCCGATGCTTA GTGGGCATATTTGCAGTCG 501 BY883550 BY884668 BY879633 FY226257
CJ051109_Contig4377 gSNP06025 CCCACCATTAGGAATTTGGA AGGTGCACCATGCCTTAGAC 429 BY883555 BY884790 BY882259 BY887568 FY226984
CJ051109_Contig4379 gSNP06026 AATGTTACCCGCTGTCGAAC GAGTTTCTCCCCAGGCTTTC 459 BY883566 FY233874 FY228505
CJ051109_Contig4382 gSNP06027 AATGGAGGAAACACAGCAGC GCAACACAAGTGTCCACCAC 523 BY887137 DC430831 BY883581 FY234386 BY895298
CJ051109_Contig4388 gSNP06030 CCACAACACAAAACGTCGTC CAATCTTTTCGCACTGAGCA 502 BY884211 BY883612 BY890393 BY886287
CJ051109_Contig4391 gSNP06032 AGACAGCGAAGACGATTGCT CAAACCCCAAGGTGCTCAT 500 BY883622 FY227564 BY882648 BY878804
CJ051109_Contig4396 gSNP06033 GGTCTCCATGATCAAATGGC CACGCTGGATCCACTCTTCT 305 BY883642 FY225697
CJ051109_Contig4405 gSNP06036 GCAAGTTTCTGTCGAAAGCC TCAGGATCAAACCCTTCGTC 523 BY883666 BY893904 BY878838 BJ939247 BY894019 BY893437 FY236463 BY892855 BY882801 BY896055 BJ938827
CJ051109_Contig4411 gSNP06040 GGTTTTGCGGCATAGAAAGT TCTGGTACGCATCTCGTTTG 508 BY883714 FY229102 FY230566 BY884499
CJ051109_Contig4432 gSNP06045 CCATCCTCACCCAAATGAAT TTGCAGAAGTAACGAGGCTG 459 BY887751 BY883786 FY227792
CJ051109_Contig4435 gSNP06047 TGGAAAGGCTTCACAGGTTC GCTCTCTGCCTGATTGCTTC 516 BY892533 BY887123 BY883808 FY233357 BY887885
CJ051109_Contig4437 gSNP06048 AGCTTCCCGCCTCTTAAAAA ACCAGCTTCCTCAAATGTGC 429 BP176294 BY885384 BY883820
CJ051109_Contig4441 gSNP06049 TCCCAAGAAATTGTTCCCTC AAACCCTCAATCCCATGACA 436 BY883838 BY892791
CJ051109_Contig4459 gSNP06055 AAACTATGGATCCCCATCCC CATCATCCCCTGTTTTGACC 498 BY885521 BY883914
CJ051109_Contig4463 gSNP06057 TGACTTTAGGTCATGTGGAGGA GAAAATAACGCAGAGACTGCAA 442 BY881691 BY883920 BY883953
CJ051109_Contig4464 gSNP06058 AAACCTTCATGGGTGCTCAG CGGGATGGCCTCTTGATAAT 330 BY896151 BY883932
CJ051109_Contig4465 gSNP06059 CTCCAACTATTGGTTGCCTG TTTTGAGTCCGACCATCCAT 483 BY887342 BY883957 BY892405 BY883929
CJ051109_Contig4476 gSNP06065 CGTGCTTCCATGGATTTCTT CAAATTTGGGGCAGACAAGT 596 BY884001 BY895427 BY893474 BY892099
CJ051109_Contig4498 gSNP06071 TGAAAGTTGTGGCTGTTGGA AAATCCAGCAGCTGAAGAGG 507 BY884079 BY885414 BY892045 FY226913 FY229009
CJ051109_Contig4505 gSNP06074 AGAAGCAGATAAGATAAAACACAACA AGTTCGACTCCCCAGAAACA 386 BY883848 DC432180 BY884120
CJ051109_Contig4509 gSNP06075 ATGCAAAGATTGATCCCGAC GAATCATGGCTGGCTAGGAA 412 BY884128 BY886266
CJ051109_Contig4511 gSNP06076 TGAAACTCAATCTCCACGCA TGTTGGATAACCTGCTGCAA 466 BY884130 BP176457 FY229735 FY232558
CJ051109_Contig4518 gSNP06079 GGCAGGTTGGAGAGAGATTG AACATGATTGTCAAGCAGCG 453 BY884151 BY891531
CJ051109_Contig4530 gSNP06084 TGCTTTCTGCTTGCTCTTCA TTCTCAAACTTGGGGGTGTC 457 BY884189 BY891422
CJ051109_Contig4535 gSNP06086 TCACTTCTCTCACACAGGCG GCTTCTTTGGTCTTCCCCTT 502 BY884201 AU084669 BY896436 FY229762 FY232949 BY890068
CJ051109_Contig4537 gSNP06087 GCAGGGATCAACTAAAGTTTCTT TGTGTGGACTAACTCATTGAAAA 444 BY884205 BY886057 FY227548
CJ051109_Contig4538 gSNP06088 AATTTTCGCATTGTGTGGCT GGATGCAACGAAAACTCCAT 396 BY880898 BY884209 BY885473 BY888745
CJ051109_Contig4546 gSNP06090 TTGTCTCTTGCTGTGCCTTG GCTTGGTGTCGGAAGAGTGT 507 BY884239 BY889071 BY894631
CJ051109_Contig4550 gSNP06092 TCCAGTACAAACTGCAACGC GGCATAAAAGAAACACCCCA 413 BY884249 BY893427
CJ051109_Contig4561 gSNP06099 ACTCGCGTTTGGCTTCAC TTGAGCCTTTTGACCCATTC 437 BY884282 BY880937 BY893656
CJ051109_Contig4563 gSNP06100 GGTTTGGAGGGTTTGTTTCA TAGCTTTTCCGCCTGAATGT 348 BY884293 BY886853
CJ051109_Contig4564 gSNP06101 CTGACAGGCAGATCCCAGTT GCAAGTGGGTCCACCACATA 500 BY884295 DC430695 BY882961 BY891839
CJ051109_Contig4567 gSNP06102 CTTCCTCGGCCTCTACTCCT AGAAGCAACGTGGTCGAAAG 431 BY884304 BY891180
CJ051109_Contig4569 gSNP06104 CCTTGTGTCTTCCCCTGCTA CGTTGAATTGGATTGTGGTG 434 BY882431 BY884314 BY889275 FY225937
CJ051109_Contig4574 gSNP06106 CAGGGAGGGAATTGAGATTG GCATAGAAGGCCAGATGAAATC 314 BY884332 BY886006
CJ051109_Contig4589 gSNP06113 CGTTTCGGGAACTGAATGTT CTTGTAAAATGTCAGCGGCA 300 BY884382 BY878132
CJ051109_Contig4603 gSNP06118 GCAGAGCTGAAGGGTTTTTG TGCAGCAGAAGTTTCAGAAGA 415 BY884421 BY881031
CJ051109_Contig4636 gSNP06128 TCCATTGCATGTATTGCGTT GCTTGCAGTTAACGAGTCCC 441 BY884537 BY894967 BY892987
CJ051109_Contig4637 gSNP06129 CTGCAACTCCAAGACCGATT TGTCTGTTGCGCATATTGGT 306 BY884544 BY884766
CJ051109_Contig4648 gSNP06133 TCAGTAATGCGTTTTGAGCG AATTGCCTGCTGACCCTAAA 403 BY884595 FY228979
CJ051109_Contig4662 gSNP06139 AAGCCTTACCGACGAGATCA CACTCGTCCCAGGTTTCAGT 455 BY889321 BY884644 BY893911
CJ051109_Contig4669 gSNP06141 TACGAAGATTCCGCCTCATC CAAACCGCAGAATAAGCCTC 597 BY884680 FY230725 BY894428 FY235751
CJ051109_Contig4670 gSNP06142 CATAACAGAAAATGCCGCCT AAGAAACTTGCGTAGGGTCG 501 DC431609 BY884682 FY231829 FY226738 DC430437
CJ051109_Contig4671 gSNP06143 GCCTTGGGATGAGAGAGTTG CACTGAACCAGGTGGGACTC 521 BY884684 BY887161 BY890225 BY895259
CJ051109_Contig4695 gSNP06150 CATTCGGGTCATCAAAGGTT AGAGGTGCTCCTGCTCTCTG 515 BY884769 FY226152 FY236202
CJ051109_Contig4696 gSNP06151 AAGGTTCTCAGGCCTCGTTT GCGTAGGGAGGGGATAAGAG 475 BY884775 FY230305 FY236503
CJ051109_Contig4704 gSNP06155 ATGGTGAAGGACGAGGACTG TTGACGCCCTCAGTATGCTT 467 BY884819 BY891072 FY229256 FY229774 BY892455
CJ051109_Contig4705 gSNP06156 GGCCACAGCTCACTCTGTTT TTGCCCTGTAGACTGTTGGA 409 BY884824 BY896671
CJ051109_Contig4706 gSNP06157 TTGATGAGCAACAAAAACGG AGGCACACAAATGTGACCAA 489 BY884826 BY896051
CJ051109_Contig4708 gSNP06158 GCTTGTCTCTCTGATACAACATTTC TGAAAAAGGACTCACACCCC 434 BY884833 BY891152 FY233933
CJ051109_Contig4714 gSNP06161 GCAAAATTCTCTCCCCTTCC TCAAAAATTGGGAAGCAACC 528 BY884846 FY226960 BY896289 BY887893
CJ051109_Contig4730 gSNP06166 CCTTCATTGAAAGAGCTGCC AATCCCACTCGTCCTCTGG 504 BY884910 AU085054 FY236755 BY889176
CJ051109_Contig4740 gSNP06171 TTTAAAGCATCCACAAGCCC TGCTGCAAACGAATTCTGAG 501 BY883255 BY884937 BY892478 FY232377 FY226177 FY230215 BY887502 BY878928
CJ051109_Contig4747 gSNP06173 GAGATCAGGAATGGGTCGAA GAATCACAGCATTTGCTCCA 509 BY884970 BY890215
CJ051109_Contig4752 gSNP06174 TTACTGCGCAACGAACAGTC TGGATTGAATGAGGGAAAGC 544 BY884999 BY880263 BY895992
CJ051109_Contig4775 gSNP06180 AGAGCTCCGATTTGGGTCTT GAGACATTGAAGGCAGTGGG 488 BY885092 BY887423 FY229155 FY234690 FY231348
CJ051109_Contig4781 gSNP06183 CGCAGAAATAGGGTTCATGC ACGACCAAGCGAAGTGATCT 543 BY885117 BY888679 BY891480 BY878068
CJ051109_Contig4799 gSNP06190 ATGTGACGTCCATGGGAAAT GGGCTAAAAAGTCCCAGTCC 564 BY878493 BY884981 BY885191 FY228010 BY888573 BY890077 BY881821
CJ051109_Contig4804 gSNP06191 CTCTGCCTTCCAGTTTACGC AATCGAACCCTGAACCTGC 471 BY885207 BY885933 FY226389
CJ051109_Contig4816 gSNP06196 GATACATGTTCTGCGACGGA GTGGCCATCGAAAACAGATT 537 BY885247 FY231583 FY227584
CJ051109_Contig4822 gSNP06198 GGTGAGCTTGTGAAACGACA GTGTCCGCGTTAGTTAGGGA 464 BY885282 FY230163 FY229542
CJ051109_Contig4825 gSNP06199 CCAGTTTGAAGCATAAGTGGG TGACTTCATTCTCTTGGGGG 474 BY885290 BP175557 BY894366 BY890713
CJ051109_Contig4846 gSNP06204 CCTCCTCTTAGGGCTGATTTG GGTTGTGTAAGCATGCAAGG 546 BY885352 FY227999 FY229271 FY227757 FY227321 FY228188 FY231044 BY891901
CJ051109_Contig4851 gSNP06205 CGATGAAAGAAGGAGATGCAG CGAGTGGGTCCATGTCTACC 408 AU084809 BY885361
CJ051109_Contig4862 gSNP06209 TGTAGACACCTGCCCAACAA ATTGCCCTCTGCCTAATTCC 504 BY885393 FY228443 FY235774 FY232823 FY229983
CJ051109_Contig4882 gSNP06215 TGCCAGAAAAGGAAAATTGG TGCATGAACTGCAACAAACA 519 BY893081 BY885465 BY886980 BY890086
CJ051109_Contig4891 gSNP06217 TCTTCTTCCGTTTGCCTCTC CCGGAGAATACATGGTCTGAA 465 BY885502 FY233456
CJ051109_Contig4895 gSNP06219 TCTTTGCATGTTGTGGGTGT GCATTGAGAACTGCACCTGA 383 BY885516 BY893104
CJ051109_Contig4898 gSNP06220 TGACATCCAAAATGAGCTGG CAATGGACTGGTTCTGGAAT 451 BY885525 BY893724 FY229879
CJ051109_Contig4906 gSNP06222 TCCAGCCCGGCTAATAAGTA GTGGTTCCATCACCCAATTC 474 BY885565 FY229389
CJ051109_Contig4908 gSNP06223 TTGGCGTGGAAATATCTTGG CATCCATTTCTGCTCCCACT 448 BY886444 BY885567 BY880392 BY891543 BY892150 FY228255 BY889756 BY878093 BY896314
CJ051109_Contig4914 gSNP06224 AGGTGCTTGGTAATGGCAAA CGACGGCTTCTACTGCTTCT 490 BY885584 BY895292
CJ051109_Contig4917 gSNP06225 GGGCCTGAAAAATTAGTTGC CTGCCTTCCAGAATTCCATC 472 BY885597 BY894154
CJ051109_Contig4970 gSNP06239 GATCTCCAAGCCTAGGCCAC CGCCCTATCTTTACCGACAA 302 BY885820 BY882889
CJ051109_Contig4976 gSNP06240 ACGGTAGTATGCGACCCCTA TGAAGAGGCTGGTTCCGTAT 498 BY885836 BY879259 BY893220
CJ051109_Contig4979 gSNP06242 TTCATTCCCGACTCGATAGC AGAGACATTGGGAACCAGGA 375 BY882659 BY885844 BY887209
CJ051109_Contig4995 gSNP06247 TTTACCCCGTTGGTTTTGAA GTAGCACATCCTTGGCGACT 447 BY885917 FY229634
CJ051109_Contig5004 gSNP06252 CATTAGGGTTTGATGGGGTG AGTGAAAGGGCAAACTAGCG 424 BY885949 BY892363
CJ051109_Contig5005 gSNP06253 GGTTGTTATATAGAGGGTAGGCCA GTTGAATATGCCATCCCCC 409 BY881822 BY885951
CJ051109_Contig5009 gSNP06254 GCAAAACCCCTAGGCCAGT ACAACCGGACTTGCATTGAC 480 BY885965 FY226418
CJ051109_Contig5046 gSNP06265 AAGGAGGACTCTACCCACCC CCTCAATTATTGCAATCGAGC 393 BY886103 BY896742
CJ051109_Contig5051 gSNP06267 GCCAGCAAATTTGATTGTCA GGGACTCTTTTTCTGGTCCAT 497 BY886130 FY230432
CJ051109_Contig5053 gSNP06268 GACTCCTCTTTGGAAGCGTG CAATACCAGTGTCGCCTCCT 539 BY886140 BY888511 FY229582 FY231995 BW996637 BW993273
CJ051109_Contig5054 gSNP06269 AAAACAGTGACGGCGAAATC CCAACCACAGGCAAAAAGAT 514 BB941526 BB941012 BY886141 FY226371 BY895085 BY891694 BY891737 FY235924 BY878826 FY234859 BJ937916
CJ051109_Contig5056 gSNP06271 CCTCAACAATGCCCATCTCT ATGACCTCGTTCGTGAAAGC 565 BY886221 BY889254 BY879390 BY884014 BY886145 FY225515 BY893938 BY888979
CJ051109_Contig5063 gSNP06274 ATCAAATTCCATTTGCAGGG TGAAGTCAATTTTGTGGGCA 440 BY886168 BY883804 BY883159 BY895709 BY887570 BY891625
CJ051109_Contig5065 gSNP06276 GTTTTTCATTTTTCCCCTTTCA TCCATCCAGTTAAGGAATTTGTC 500 BY886174 BY878882
CJ051109_Contig5077 gSNP06282 CATGCCAAATTCAACAGTGG GCGAGGTAAAATTGTGAGGG 508 BY886200 BY892462 FY229347 BY886515 BY896075 BY879713
CJ051109_Contig5078 gSNP06283 AGCCCAGAAGATATGGCATC TTAGCCAGGCAGGACTCATT 461 BY886208 DC430926 FY235038 BY893143 BY893274 DC430529
CJ051109_Contig5087 gSNP06285 CGGTACGATATCCAAGTCCAA GGAGGAATGAATTCGGCATA 451 BY886243 AU299185
CJ051109_Contig5108 gSNP06291 GCTGAGCGTATGCACAGTTT TCAAGCGAAAAACACAAAACC 421 BY886318 BY894936
CJ051109_Contig5111 gSNP06292 GGTCATGTTTAATATCTCTTGGGG TTCAAAATTGCCAGGTCTCC 438 BY886327 FY226646
CJ051109_Contig5116 gSNP06294 CTGTGGTTGTTTGGAGGAGC GAACTGTCTTCCGCTTCGTC 332 BY886344 BP176383
CJ051109_Contig5146 gSNP06302 TCCCTTCCCTACAATGGACA CAGCATTCTCGTGACGTTGT 580 BY886469 BY887776 BY888646 BY894111
CJ051109_Contig5152 gSNP06304 CTCCACAACAGCTGCCATTA CAGCTTTAAAAGTGCCCAGC 452 BY886493 BY889086 BY889575 FY231220 BY888483
CJ051109_Contig5155 gSNP06307 GGGCAGAATGTTTGACGATT TCAGGCATGACCTCAATCTG 499 BY882492 BY886502 BY894195
CJ051109_Contig5158 gSNP06308 GATACAGACGATGATGCCCG CAACCTGTTTCTGCACTGGA 495 DC432042 BY886540 BY889924 BP176221 BY880207
CJ051109_Contig5163 gSNP06309 ACGCAGGGTCATATCATTCC AGAAAGCAAATGCTCCCGAC 427 BY886563 FY232358
CJ051109_Contig5166 gSNP06310 CATGCCGTCTCCTTACAACA ATGCCGTGAAATTGTTCTCC 470 BY886586 FY229413
CJ051109_Contig5172 gSNP06312 TGGTGGGTTCAGTTTTAGCC TAACCAGCCGCCATATTCAT 447 BY886618 BY887584
CJ051109_Contig5177 gSNP06314 ATGCGCTCTATGGGTGATTT CACTGTTGAAAGCCCAGTCA 520 BY886629 FY235703 FY225843 BY892530
CJ051109_Contig5179 gSNP06315 CCTGCCCACAAGTGAAAGAT GCTCCCAACAATTGTGGTCT 454 BY890549 BY886637 BY893487
CJ051109_Contig5180 gSNP06316 TTCATTCCGGTTTTTCAAGG AAGGCCTCCATTTGGACCTA 410 BY891116 BY886639 FY235067 BY887449
CJ051109_Contig5193 gSNP06317 GAAGACGAAAATCCCCAATTC GTTTCAGAGCTGCAAAAGCG 333 BY886690 BY888632 BY889252
CJ051109_Contig5195 gSNP06318 CGAGGCAAGAAGAGCACAG CTGCTGGGCAGATTAGGATT 504 BY883028 BY886701 BY894372 BY887291 FY227662 BY893234 BY878018 FY225867
CJ051109_Contig5205 gSNP06323 ATCAGTTGACCCAGGCAAAA TTGCAGCAATGCTTGAAGAC 447 AU085562 BY886741 FY229387
CJ051109_Contig5212 gSNP06326 ATGCTTAAGGAGGGGCTGC GCAAAGGAGGCTCTTGCATA 502 BY881454 BY886759 FY234901
CJ051109_Contig5224 gSNP06330 GCCATCAATTTGAATACGCA TGATTTCAGTGCTGAAGCGT 310 BY886807 BY888746
CJ051109_Contig5230 gSNP06334 CATTGGATGTCATGAGTGGC AGTGTGATAAGCCAGGCACC 548 AU298881 BY886830 BY893228 AU299521 BY879737
CJ051109_Contig5233 gSNP06335 GCAAACATGGAGATGGGTTT TGAATGTGGGCTAATGTGGA 464 BY884008 BY883309 BY886839 BY882937 BY895960
CJ051109_Contig5256 gSNP06339 AGCTCCCATTTTGACACAGG CCTGGGCTTAATTGTTGACC 426 BY881204 BY886926
CJ051109_Contig5259 gSNP06340 CCATGTCAATGGGAGAAACC GTAACGCAGAAAGCATCCGT 395 BY886962 BY886946
CJ051109_Contig5264 gSNP06343 TAAAGGACTCGGCAGGACAC TCTTCTGAAGGGTCCAGTGC 467 BY886967 FY229556
CJ051109_Contig5273 gSNP06344 GGGATGAATGCTTCTGCAAT CCTTAGGCAATGGGACTCAA 456 BY886996 BY878874
CJ051109_Contig5275 gSNP06345 CATTGTTAGCGTAGCAGCAGA GTAACGAAGGCAGCGGAGT 417 BY887000 FY235324
CJ051109_Contig5278 gSNP06346 TTGGTTTTCTGAGCTCATTGC TTTTACACAGAATCTCCCCCTC 437 BY887005 BY884451
CJ051109_Contig5324 gSNP06363 CTCCTTTTGTAGTGGGGGTG CGCCCCAATATCAACATACC 364 BY887193 BY896025
CJ051109_Contig5332 gSNP06367 TCCAATGCACATGCTCAGAT CAGGAGGAACAAAATGGCTC 488 BY887234 FY233499 BY892460 BY892672
CJ051109_Contig5348 gSNP06374 TGTAGCAGATTGTTTGAGGTGG TCTTCTCTGGTGCGAGGATT 444 BY887301 FY234516
CJ051109_Contig5355 gSNP06375 CCTCGGTATCCCACGTCTAA AGAAGAGTGCCCCTTGCATA 590 BY887325 BY881511 BY894601 FY228795 FY236372 BY892483
CJ051109_Contig5359 gSNP06377 GCAACAGGTTCATATGCGTG TGCATCAAGACATTCCCTCA 401 BY894423 BY887333
CJ051109_Contig5367 gSNP06380 TGAAAGCCTTTTTCATTGGC AGCCTGGCATGGTTTTACTG 576 BY887369 BY890391 BY889250 FY226446 BY895674
CJ051109_Contig5371 gSNP06381 ATGGCCGTTTAAACTTCACG GCCCCTGCACAACATTCTAT 424 BY887380 BY892397
CJ051109_Contig5431 gSNP06396 AAAACTCAATTCTTCGGCCA ATTAGGTAGCGTGACGGTGG 459 BY883996 BY887637 BY896498 BY892965 FY236670 FY225806 BY896590 FY226965
CJ051109_Contig5440 gSNP06400 AAAGGAGTTTGAGGTCCGGT GACTCTGCCTGTGTGACGAA 591 BY887681 BY887155 FY230060 FY232362 FY227533
CJ051109_Contig5456 gSNP06409 GAGGTGAAAAAGGGCAACTG GGCTCCCATGTGTTTTGACT 459 BY887752 FY226076
CJ051109_Contig5458 gSNP06410 TCATGGTTTCCTGATCTAGTTTC CTGCGTTTGCAAAGATTGTG 504 BY889281 BY887762 AU299444 BY886905
CJ051109_Contig5464 gSNP06411 TCCGTAGGTGAGGGAGATTG GAGCAACATTGTGTGGGAGA 510 BY887809 BY885791 BY879677 BY883111
CJ051109_Contig5475 gSNP06415 GTCTCTTCTCCTCCCCTGCT CTGCTGCGAATGCAACTAGA 507 BY887849 BY891147
CJ051109_Contig5488 gSNP06421 GACAATTTTGGACCGGAAGA CGTCTTCAATGCTCCAATCA 547 BY887892 BY889306 BY889479 BY892691 BY886575 BY888913
CJ051109_Contig5492 gSNP06423 TTGCAGCAACCTGAGTTTTG TGCCAATTTCAGGGCATATT 454 BY887919 BY887092 BY892980 BY887886
CJ051109_Contig5497 gSNP06424 CGGCGAATTGAAACTCTCAT GGTGCCCAATCTTTTACCCT 414 BY887937 FY231650
CJ051109_Contig5507 gSNP06428 AGATGAAGGGATTGCAGTGG AACGGAGGAGTTAACCGATG 448 BY887979 FY230932
CJ051109_Contig5516 gSNP06430 TGGGATCGGTAGTGTTGTGA TCCTTCGAGGCAAGACAGAT 594 BY878561 BY888015 BY882296 FY233937 BJ940279
CJ051109_Contig5525 gSNP06432 TTTGTTTGGAAAGAAGCGGT CAGTCTAGCGTCCCTTGCAT 470 BY883660 BY888071 FY235059 BY889890
CJ051109_Contig5529 gSNP06434 GCTCAAAAATCCCTCACAGC GGTTTAATGGCAGGCAAGAA 446 BY888088 FY230945
CJ051109_Contig5531 gSNP06435 TGCGAAGATTTTACTTCGGG CCCTAGAAGACCCACATCCA 516 BY888095 BY883363 BY885527 BY895120 BY885661 BY883271 BY887076 BY889974 FY234080 BJ938534
CJ051109_Contig5537 gSNP06439 GGTCGGAAAGGACATTGAGA ATCTTGCAAATCCGGAAGG 332 BY888118 BY882808
CJ051109_Contig5560 gSNP06448 CTGGATCTCAAAGCAAATTCC CTGTCTTTGTCTCGCCGAA 470 BY888223 BY892750
CJ051109_Contig5562 gSNP06449 CTGGGTCAAGATTTATAACAAGAGG ATCCCAACTTGTTTGGCTCC 419 BY888226 FY232309
CJ051109_Contig5583 gSNP06456 TGCTCATTTTGGCTTACGAA TGAATGCTCCTACCCCAATC 522 BY888276 BY895731 FY232350 BY890199
CJ051109_Contig5585 gSNP06457 CTGCAACAGCAAAAACTGGA CTGTTCTCGCGATTGGACTT 447 BY888282 FY228829
CJ051109_Contig5590 gSNP06461 AAAGCCCTGATGTTTCTTGC AAGTTCCAAAATCATGCCGT 416 BY888296 BY894745 BY882142
CJ051109_Contig5591 gSNP06462 ATCTTTTTCACTGCATGGGC TCTGGTGATGGGTTCTGTGA 497 BY888300 BY889175
CJ051109_Contig5603 gSNP06466 TGAGTGTGGACGAGTTTCTCA TAATGTGCGTCCTCTGCAAC 439 BY894961 BY888555 BY888330
CJ051109_Contig5609 gSNP06467 GGCTAGGGCTAGGGTTTGAC CCCAAATTTGCTGAGCTCTT 509 DC431767 BY888349 FY226579 FY234520 FY229795
CJ051109_Contig5622 gSNP06473 AAATCACAGATCTGCAGGGG TGGGGAAAATGGGTATCAGA 423 BY888397 AU084301
CJ051109_Contig5623 gSNP06474 CCCGATTTATTCCTGCCTAGA TCAGGTCTGTGTCTTGTGGG 326 BY888248 BY888405
CJ051109_Contig5626 gSNP06476 AGTCTTGTGTGTTTGCGTGC CACTGCCACCTTCATTTTGA 406 BY888423 BY893909 FY235400 BY886406
CJ051109_Contig5629 gSNP06478 GTTTGCAAGGCAGGCTAAAG TTTTACCAGGAGGAATGGGG 515 BY888440 BY884127 BY887880 BY895267 BY896740 FY229492
CJ051109_Contig5636 gSNP06482 GGTTTTAAGCAGAACCCTTCA GCAATCAGGGACTTTCAAGC 485 BY888473 BY893861
CJ051109_Contig5638 gSNP06483 TTTTCCCACCTCACCAACTC TAAGCCAGTCAACTGGGGAC 536 BY888482 BY883628 BY887530 FY226588
CJ051109_Contig5652 gSNP06487 TTTCTCTGCATTCTCATTCTCG ACATCCAACCCACCATCATT 423 BY880079 BY888537
CJ051109_Contig5653 gSNP06488 CCCCGCTTAGGATTTTGTTT GGTGTGGAGTGAATCCCAAG 440 BY888538 FY233191
CJ051109_Contig5655 gSNP06490 TTTTGCTCCAAATAGCCCAG ACCAACATAAAGGGCACAGC 432 BY888549 BP176421 BY881426
CJ051109_Contig5703 gSNP06508 GTAATCCGCCCAACACATCT GCAGCGGTACGTATGTGGT 415 BJ936985 BY888692
CJ051109_Contig5725 gSNP06517 AGTCACGACGCTCGCTAAAT TAGAAAAACGCCAATGGAGC 455 BY888770 BY895716
CJ051109_Contig5726 gSNP06518 AGGGATTGCAGCCAAAATAA CGCATAGAAGAAGTCCCCAA 519 DC431229 BY888771 BY891055 BP176517 BY892513 BY895002
CJ051109_Contig5730 gSNP06520 GAAATGCTCGGTCCACTGTT TTTGGAAAAGTGAGGGTTGG 552 BY888793 FY227265 AU084095 FY232902 FY229581
CJ051109_Contig5754 gSNP06527 GGGCCATCTTATTCCTTTCC CGTCGTCTCCTTCCACATTC 500 BY885770 BY888895 BY889357 BY889413 BY889774 BY890456
CJ051109_Contig5758 gSNP06530 CAAAATGTCAGGCGGAAAAG CCCCACCTATTAACCTCGCT 555 BY890813 BP176671 BY890117 BY888905 BY895595 BY891305 FY226352 FY230196
CJ051109_Contig5760 gSNP06532 ATTGCAGATCACCCACCTTC CAACAGGTGCATATGACCATACA 503 BY888908 FY228121
CJ051109_Contig5774 gSNP06535 TTCTGTTAATCTCCCAAAAGAAGA AACACCAAGACAATCGGACC 402 BY888957 AU085263
CJ051109_Contig5793 gSNP06542 TTGCATTTTACGCTGTTTCG AATCTCGCCCTTTCTCACAA 587 BY888576 BY890536 BY889015 FY229533 BY882361
CJ051109_Contig5797 gSNP06544 CTGAGGCTGAGGCTCTTGTT ATTGATACGACCGTGGCCT 320 BY881373 BY889025 BY891094
CJ051109_Contig5803 gSNP06546 GGCTGTCAATAATGGCGTTT CTGGACTGATCTCTCGCTCC 528 DC432132 BY893532 BY882321 BY889048 FY225813 BY893159
CJ051109_Contig5833 gSNP06553 ACGAACAAACACACTGTCGC CTGAATGCATTTGTAGCGGA 506 FY226956 BY889146 FY229373
CJ051109_Contig5835 gSNP06554 TGCTTCCCTTAGATTCTGCC TCTTCTTTCAGCGGCTCTTC 539 BY889166 FY233346
CJ051109_Contig5841 gSNP06557 TAATAAGATGGGGTGCCAGG GATAAACCAGGGTGCAGGAA 361 BY889184 BY880417
CJ051109_Contig5855 gSNP06561 AGATCCCAACCCTGTAACCC CCCGAAACGACATAGGAGAG 432 BY888443 BY889234 BY886641
CJ051109_Contig5870 gSNP06565 CTCTTTCCACGAAATCAGCC ACTCTCATTGTTCCCCGATG 529 BY889300 BY893720 BY895117 BY881041 FY232336
CJ051109_Contig5873 gSNP06567 AAATTGTTGAACTCCAGGCG TGACCCACACCTGAGAAACA 506 BY889320 BY881084 BY880484
CJ051109_Contig5884 gSNP06572 GGAAATTGGAAGTCCGGAAA CCCGCTTTATTCGTCAATCT 420 BY889364 FY229273
CJ051109_Contig5919 gSNP06585 CCTGCATAGATTGCAAAGCA TTTCCCTTTGCATCAGTTCC 415 BY889502 BW997170 BW996713 BW997178
CJ051109_Contig5920 gSNP06586 GGCAAGCCCGATAGTAAAGA TTACCTCAGAGGGCGAATGT 516 BY889507 BY889702 BY892256
CJ051109_Contig5927 gSNP06588 AAAATAGAGGGTCGGGAGGA AAGCCCTTGCAAAATTCAAA 329 BY889538 FY231436
CJ051109_Contig5942 gSNP06592 TGTTTCAGGTTCCTTGGGAG GTGCCCTGCATAGCTTTCTC 487 BY889596 BY894174
CJ051109_Contig5951 gSNP06594 ACTGGCTAGTTTTGGTACTGATCT TGGAATGTTGCTATTGTTGTTATTT 322 DC430853 BY881823 BY890752 BY889633
CJ051109_Contig5957 gSNP06597 TCCCACTGGAACACAAATGA GAAAGATCATAACCGGCAGC 318 BY889644 FY233229
CJ051109_Contig5960 gSNP06598 TTAAAATGATTCATACTGTAGCCAA TTTGTTTTCCACTTTTGCCA 427 BY889661 FY226663
CJ051109_Contig5969 gSNP06599 TGATAAGGTGGCCGTATTGA CTTATCCCATGCCATACGCT 591 BY889701 BY879199 BW992842 AU299312
CJ051109_Contig6019 gSNP06612 AGGTAGGCCTTGGGTTTTTC CCTTCAATGCGTGACTGTGT 405 BY879450 BY878127 BY889883 BY879668 BY893738 BY880278
CJ051109_Contig6028 gSNP06616 TGCCTTAAGAATCTCTCCCG GCTTGCCGTCTTCAGAGAGT 431 BY889913 FY230207 BJ939009
CJ051109_Contig6036 gSNP06619 AAATCTCACCACCAAATCGG CCTTGCCAAATTCACAGGTT 512 AU084154 BY889943 BY887534 BY888971 FY233057
CJ051109_Contig6038 gSNP06620 GAAGGAGATGGATTTCTGCAA AAGTGATGGGAGAGGAACCA 446 BY889949 BY882139
CJ051109_Contig6043 gSNP06625 ATTGCAATGCATTTCTAGTGTGA ATACACCAGGGGAAGTTTGC 400 BY889979 BY896155
CJ051109_Contig6054 gSNP06630 CCAGTGTAAATGGCGGAGTT TTCTGAGCGATTTCGTGTTG 448 BY890022 FY232060 FY228146
CJ051109_Contig6059 gSNP06632 GTTTTAACAATGGCAGCCGA CAGCTCAACCTGCTCTCTGA 432 BY883499 BY890048 FY231537 FY228025
CJ051109_Contig6060 gSNP06633 TCTTGTCGGTTGCTGAAGTG TTGAATATCGGCATCCAGGT 487 BY890056 BY882700 BY884583 BY890262
CJ051109_Contig6069 gSNP06635 AGGAAAAATTCCCGGATGTC TTGGAGATGTTGAAAGCCCT 529 BY879420 BY890104 BY890196 BY886027 FY227269 BY890633
CJ051109_Contig6077 gSNP06639 CTAGGGAAAGTGGGAAGCG CAGAGTCTCTTGTGATGGCG 444 BY889882 BY890142
CJ051109_Contig6078 gSNP06640 ATTTTGCCTTTCGTGTTCCA GTGGCTGGTTTTCACCTCAT 441 BY896535 BY890144 FY226383 FY226310
CJ051109_Contig6085 gSNP06645 ATTGAAAAATGACAAGGCGG GAGATCGAAGAGACGAGGGA 383 BY890172 AU085598 BY892908
CJ051109_Contig6086 gSNP06646 GAGGTTTTACAGAGCCTGCG ACAAATTCACAGAAAGGCCG 423 BY884547 BY890174 FY228796
CJ051109_Contig6094 gSNP06650 CTCCACCAGAAGGAAGCAAC ACACCAAATTTTGAGCCGAC 505 BY890186 FY231709 FY233041 FY227581
CJ051109_Contig6101 gSNP06652 TCTCTTGACGCTTCCTCCTC TATTGGCCTCGAACCACTTC 417 BY890217 BY893643
CJ051109_Contig6127 gSNP06660 GACATCTGTGAACAACGGGA AGAGCACAGTATCTTCGCCC 400 BY890323 FY229392
CJ051109_Contig6134 gSNP06662 TGGGAATGTCTTAACCAGAGC CGTCCAGACATTGAGCGTC 425 BY890336 BY880236
CJ051109_Contig6142 gSNP06665 GAGACCATTGAGGCGAAAAA TTCGCTCTGCCTTTTCTTGT 507 BY890356 BY886170 FY232873
CJ051109_Contig6145 gSNP06668 GGTGGGTTTGCTTCATCAAT GCAGGAAAGCAACACCAAAT 354 BY890370 BY892439
CJ051109_Contig6149 gSNP06669 ATGATCAGATGGGCTCAAGG GCAACAATCGAAGACCATCA 423 AU298767 BY890382
CJ051109_Contig6154 gSNP06671 CCGTTTCAATTTGGGAAAAA GCTGTTGTTGGTGGAACTGA 413 AU084762 BY885029 BY890399
CJ051109_Contig6163 gSNP06674 ATTGCTCACCCAATTCATGG CGACATCTGTTACCTTGGGC 523 BY890439 BY881819 BY884343 BY896176 FY225544 BY883677 BW992587
CJ051109_Contig6166 gSNP06675 AGAATATCTTCCGCCGGAGT GACGGATGATCGAAAACCAC 537 BY878203 BY883897 FY228798 FY228996 AU299140 BY890461 BY890076
CJ051109_Contig6167 gSNP06676 GTCGCGCTTGTTTTCAAT ATTAATCGGGAATCGTCGC 456 BY881590 BY890463
CJ051109_Contig6170 gSNP06677 ATTTATCCATGCCCGAATGA CAGAGACCCAAAACTCAGGG 316 BY891117 BY890481
CJ051109_Contig6197 gSNP06685 CTGCTGTGGTTTGGAGAACA TTGTCTCCCTTGGGTTGAAA 519 BY885983 BY883356 BY884429 BY890585 BY896557 BY896214 FY232372 BY896325 BY886252 BY887678 FY228253
BY892950 BY879873
CJ051109_Contig6200 gSNP06686 TGAGCGTTAGTGTTGTTCGG CCCCGTTTGAGGTAATGAAA 593 AU083650 BY890603 AU299341 AU083914 BY896680
CJ051109_Contig6212 gSNP06692 TACGTCAGCATCAGTCCAGC TGCATTTCCTGTGTCGTAGC 448 BY890655 BY894563
CJ051109_Contig6232 gSNP06700 TGCATGCAGAGGATTAGCAG ATTCTGAAATGGGCTTGTGG 493 BY890731 BY894480 BY895844
CJ051109_Contig6236 gSNP06701 ATGAATGGGAATGGCTCAAG ATTTTGGCAAGCCAATCAAG 446 BY890749 BY890928
CJ051109_Contig6256 gSNP06710 GGGTAGGTGTTCAGTTGGGA TCCTCTTTCATCCAACCCTG 528 DC430844 BY890866 BY895747 FY228058 DC430979
CJ051109_Contig6257 gSNP06711 CAGCTGCTAATGCTGAGTGG TCACAGATGGGTTGTCCTCA 448 BY890870 BY891246
CJ051109_Contig6265 gSNP06713 TGTTTCCCCCTTTCTCTCCT AACAGCGTGTGTGCTACCAG 420 BY890903 AU084485
CJ051109_Contig6270 gSNP06715 ACCGTGTATTTTCGTCTCGG CATGGGAAATCAAATCCACC 447 BW992871 BY883933 BY890921 BY891470
CJ051109_Contig6289 gSNP06721 AGCCGCAACCTGTTCAGAG GGCAAAGACAGTGAAGCAGA 400 BY893417 BY891004 BY880963
CJ051109_Contig6290 gSNP06722 AGAGGTGCACAAAAATGCCT GTCAGCACCCGTCTTGAACT 452 BY893211 BP176586 BY891007 BY894255 FY226820
CJ051109_Contig6293 gSNP06724 AAGGGCAGGGCATTATACCT TTGAAGAGCTTTCGCATGAA 502 DC430998 DC431694 BY891021 BY877989 FY227694 DC432525 BY894889
CJ051109_Contig6294 gSNP06725 TGATTGCCGCAGATTGAGTA TCATCCTCCCCTTTTCCTTC 437 BY891022 BY893084
CJ051109_Contig6295 gSNP06726 CATCGAATTTATTATGATCACCG AAAACGGTGTTTTCCGAGTG 443 BY883305 BY891027 AU084731 BY882810
CJ051109_Contig6310 gSNP06728 TCCAGCCCAAATTTTAATGC ATGATGGCTTTCCTGATTGG 375 BY891083 BY890360
CJ051109_Contig6316 gSNP06730 TGTTCCTGCAAACCCTATCC CACGTCACAGCTGAAAGGAA 473 BY883027 BY886730 BY891109 BY887978 BY890682 FY233658
CJ051109_Contig6318 gSNP06732 CACGATGAACGACAGAGAGG AGAGCTGAGCCCAAGAAAGC 505 BJ939883 BY891114 BJ937318 BY880503 BJ937977
CJ051109_Contig6321 gSNP06734 TTTTTCTGGGCACGAAATCT GGCGTCGAAGACAAATTGAA 450 BY892758 BY891123
CJ051109_Contig6324 gSNP06735 GTTTCGACCCCGTTCTTCAT GAGGGCAACTCACAGGAAGT 327 BY891131 BY896634
CJ051109_Contig6344 gSNP06740 GCCCTAGGCTTTCCAGTACC AAAACGCCTTATTCTCCCGT 577 FY236026 BY891220 BY890462 BY893735
CJ051109_Contig6346 gSNP06741 GGGACAAGCTTGCTCAGTTG TTGGCTTTGCTTCTTCAACC 531 BY883757 BY891225 BY888336 BY893318
CJ051109_Contig6350 gSNP06743 ATCAATGGCGACGGAAGTAG CGAGAGACAGCGGAGTACCT 501 BY881508 BY891247 BY894946 FY226695 BY881851 FY228156 FY229069 FY233929
CJ051109_Contig6351 gSNP06744 GCGCCTGCATAATTTGTATC GAATTTCCGGGTCTGCTGT 459 AU084794 BY891248
CJ051109_Contig6358 gSNP06746 AACCAAATTCACGGAGCAAC GTTGGGCATCGTATCGATTT 572 BY878258 BY885654 BY886817 BY885401 BY891270 FY229543 FY226953 BY890555 BY895931
CJ051109_Contig6360 gSNP06747 CGGTCTGCTAAACGATTTCC TGCTTAGGAGGAGGAGCTGT 462 BY891274 BY888028 FY232212
CJ051109_Contig6362 gSNP06748 TTGATTTTTCGCAGGGTTTC TGCAAATGACCAAAGCAATG 499 BY891276 AU299189
CJ051109_Contig6373 gSNP06751 CCCAAAATCCTGTGCATTCT TAATACAGGGAGCAGGGGTG 526 BY891317 BB940726 FY227604 BY877906 BY889060
CJ051109_Contig6376 gSNP06752 TGAAACTAATTTGGCACCCTG TTTCGTACTTCTCACTGGCAAA 409 BY891337 BY892493
CJ051109_Contig6387 gSNP06755 TGCGTTTCCAATCTCTTCCT TGTAACAGCACCCTTCTCCC 478 BY891373 BY893362
CJ051109_Contig6390 gSNP06756 ACAGAGAAAGGCGAGGACTG TTGCTGAATCGACCACAAAG 440 BY889744 BY891390
CJ051109_Contig6398 gSNP06760 AGCAGGATTTCATTCCATCG AACAGGGAATTGAGCGTGTC 432 BY891426 FY229145 FY236368
CJ051109_Contig6405 gSNP06762 TTGGAGCAAAGACTCAAGCA CTTGACCATGGGATCTGGAC 500 BY891450 BY891695
CJ051109_Contig6412 gSNP06766 TCAATCATGTTTCTGCCCAA ACGCTCAACCAAAAATGGAG 467 BY894990 BY891483
CJ051109_Contig6429 gSNP06771 TGCCTTCACTTCCTGCTTTT TTGCCATTCTCGGACAAAAT 510 BY891577 BY889752 BY891089
CJ051109_Contig6436 gSNP06776 CTTCTCCTGTTTCCCTTCCC ATTTTCCATGTCGTTCCAGC 470 BY891616 FY234217
CJ051109_Contig6444 gSNP06778 CCAGTGAGAAAGAGGGCAAG GCTAACTGTCCAGCCGAAAG 512 AU084659 BY895119 BY891643 FY230610 FY234541 FY232433
CJ051109_Contig6454 gSNP06782 AGTGGGAATTCAAAGGGGAC TTTCTGAACCCAATTCAAATTCT 451 BY893023 BY891688 FY236549
CJ051109_Contig6470 gSNP06786 TCTCGTCCAGAAGGTTTTGA CGGCTGCTCTTCTTCTTTTT 496 BY894668 BY891736 BY884063
CJ051109_Contig6482 gSNP06791 GAAAGAATCCGGTTTGGTGA CCACAATATGGCTAAGCAACG 506 BY891774 FY234952 BY885736 BY890044
CJ051109_Contig6504 gSNP06802 AATTAGGCGATGGTTGTTCA CAAGCTCCTGCCTAATGAGC 501 BY887748 BY891847 BY878718 BY890304
CJ051109_Contig6508 gSNP06806 GCAAGAAAAATGGGTGCAAT CTACCTCCACCACCAACTGC 548 BY891855 BY885319 BY882517 BY881111 BY892807
CJ051109_Contig6510 gSNP06807 GGAAATTAATGCAGGGCAGA AGTGCATTCTCCATTGGGAT 364 BY891860 BY895414 BY884669
CJ051109_Contig6518 gSNP06813 GGTGAGGAAACGTAGGGTGA TAAAGGCCTCAGAAGCAGGA 526 BY891885 FY235285 BJ939630
CJ051109_Contig6526 gSNP06815 ATGGGAAGCACAAAGTCTGG TCCAGAGGCCAAATAAGCAG 516 BY891924 BY892015
CJ051109_Contig6531 gSNP06816 AGGAAGAAGCAGAGTGCTCG TACTCACCTTTCTGCTGCCC 503 BY881033 BY891939 BY894988 FY235998
CJ051109_Contig6537 gSNP06817 GGGGGTTTTTATAGAGCAAGAAAT TCATCATGATCATCCCAACC 474 BY891976 BY883310 BY883253 FY228520
CJ051109_Contig6547 gSNP06822 TTTCCTTCCTGGCGTAATTG GCTCTCAGGTGGTTGAGCAT 510 BY891326 BY892016 FY226540 BY896533 FY233866 BY882287
CJ051109_Contig6549 gSNP06824 CCCCATTATGCCAATCTGTT TCTACCAACCGAGGGACAAC 553 BY883710 BY892018 BY894629 FY232170 FY234017 FY228811 FY234281
CJ051109_Contig6552 gSNP06825 ATTCCCGAATCCCCTATCTG GCTTGGATTGGAACAAAGGA 474 BY892028 BY887396 BY887614 FY231676
CJ051109_Contig6557 gSNP06826 ATAGGCTTTTTCCTGCCCAT CTCCGCAACCTGTGAAAGAT 439 AU083610 BY892062
CJ051109_Contig6559 gSNP06827 TTGAATTGTCTCCAATATCACAATC GCAACAACATGATTTCACAGG 500 BY892077 BY892902
CJ051109_Contig6565 gSNP06830 CAGGGGTTTATCGGGAAAAT CACGAGAAAAGCGCAATGTA 492 BY892088 BY883011
CJ051109_Contig6581 gSNP06831 AATCACCTGTACCGTGCAAA AGATCCTTGGCATCCACATC 435 AU084638 BY892172
CJ051109_Contig6590 gSNP06833 AAACCAAAGACACCCACGAG TCCACCAAGTCCAAGGCTAC 575 BY892206 FY226621 FY236149 BY882775 BY888449
CJ051109_Contig6591 gSNP06834 TTGCTGGTGCTTGCATTTAG TTGTGGGAGAGGCTAAGGAA 419 BY892211 FY225880
CJ051109_Contig6599 gSNP06837 TCAAGATGGAAACATTGGCA TCAACAAGAAGGCTCAGGAAA 509 BY888683 BY892263 BY886351 BY893433 BY893842
CJ051109_Contig6610 gSNP06843 GAAGGGATTGCTCGATGGT TGTACTTGATCAACCAAACCCA 302 BY892299 AU083646 AU083789
CJ051109_Contig6625 gSNP06847 CCTCAATGTTGATTTCCCGT GCAGAGGAGTTGAAACAGGG 442 BY892341 DC430938 AU084111 FY229706
CJ051109_Contig6635 gSNP06849 TTCGTGATCGTGTCTTGTCC AACCATAAAATGCACGAGCC 346 FY234030 FY228842 BY892375
CJ051109_Contig6641 gSNP06850 TGAAAACAGGGAATAGTTTGCAT CGGCATACTAGACATGGGCT 473 BY892399 FY230638
CJ051109_Contig6653 gSNP06856 TCTGGTTGTGCTCACATGGT TGTGGCAACAGATTCAGACC 553 BY892445 BY877911 FY229134
CJ051109_Contig6654 gSNP06857 AGAACCGGATTCAGAGCTATC TGCTAATCCAATCTTATTACCCA 413 BY892446 BY884892
CJ051109_Contig6677 gSNP06867 GAAGCACTATTCAGGCCGAG ATCCGGTTGCAATGTTGACT 486 BY883810 BY892547 BY879189 BY891129 BY892578
CJ051109_Contig6678 gSNP06868 TGGGCTTAGTTTTGCATCCT TGCAGAATCAAAGCTTCCCT 450 FY232251 FY233940 BY892551
CJ051109_Contig6693 gSNP06872 TGTATTCTGTTGTGGGCAGG AGTAGGCCCTCCCGTTTTTA 402 BY892629 FY233657
CJ051109_Contig6695 gSNP06873 AGGGGAGAACGCTTATCTTG AGCCACCTCCACTTGCATAC 458 BY892634 BY886275
CJ051109_Contig6702 gSNP06876 GCCCTTTTTGCTGGGTTATT CGCTGAACCCTGAGGACTAA 500 BY892651 BY891205
CJ051109_Contig6705 gSNP06878 CCCCTTAAGCAGCAGAATGT CCCACTCTGCTGTTCTGTCA 469 BY892678 FY232697
CJ051109_Contig6716 gSNP06881 AAGAGGTGCGACTGCATTTT TGAAAGCCATCAATGCATCA 437 BY892720 FY236098
CJ051109_Contig6726 gSNP06884 GCGCGGATTAAAGCTACAAG GGAATAGTTGGCTGATCCCA 569 BY892760 BY892417 BY881796
CJ051109_Contig6755 gSNP06888 TGCTGAATTTTAGCTGCAGTG ACACTTGTCTGACCCGATCC 526 DC432020 BY892876 BY894996 BY893624
CJ051109_Contig6758 gSNP06889 CTGCACTCAAATTCTTCCCA AGCAGGTCAGAAGAGGAGGG 342 BY892883 BY878311
CJ051109_Contig6762 gSNP06890 AAATTCCGGGCCTCTGATAG CAGAGCCATCTGAAACACGA 472 BY892896 BY893031
CJ051109_Contig6775 gSNP06896 ACAAAAAGAGATCCAGGCGA ATCCGTGCTGACATGAATGA 506 BY892954 BY891889
CJ051109_Contig6778 gSNP06897 TTGGCGACAAGAACAGAGAG CCCCTCCATAGCTTTAGCCT 470 BY892964 BY893129 FY233130 FY228283
CJ051109_Contig6779 gSNP06898 CTCCTTTCCTTCGCAACAAC TGCCTTCTGTGCATCTTCAG 463 BY892966 BW993811
CJ051109_Contig6785 gSNP06900 TTTTCAGGAATTTTATTCAAACG TGACACCAAAAGATAAACAAATGAA 502 BY881444 BY883563 BY893000 FY227253 FY229788 BY895228
CJ051109_Contig6786 gSNP06901 GGATCAGGATCAACTCTCTAACTACT CGATTGTTTGTTCAGCTTGC 454 BY893001 BY884182
CJ051109_Contig6800 gSNP06910 AAATCTTTCATTAGCAAGGGGTC TGTGAGACTAATTGCGACAGTTT 500 BY893078 FY234001
CJ051109_Contig6820 gSNP06918 GTTATTTAAATTAGCGGTGATGGT GGCCTGCTCTCAAAAGAATC 401 BY893125 FY229416 BY888755
CJ051109_Contig6831 gSNP06924 TCGAATACGGGCAAGAAGTT TCTGGAGGATCATAGCCGTC 536 BY893181 BY880581 BY880579 BY891566 FY228455
CJ051109_Contig6837 gSNP06925 TCATGTCGCGTCAAAGTAGG ACCATAACGGTGTCTCCAGC 476 BY893199 BY882527 BY895150 BY889765 BY885735
CJ051109_Contig6842 gSNP06926 TCCCAACACTGCATTTTTCA CATAACAGTAGGGGCATGGG 465 BY884277 AU084832 AU084526 BY893235 BY885993 BY880176 FY232673
CJ051109_Contig6845 gSNP06927 TCTTTCTTGTAGAGGGGCGA GCAAACTGTTTTCTCTGCTGG 554 BY892635 BY893248 BY893627 BY892501
CJ051109_Contig6855 gSNP06931 AGCACAAGAAAATGGTTCCG AGCATCTCTGTGTCCCTCCA 457 BY893288 FY233049 BY888720
CJ051109_Contig6871 gSNP06940 TCCAGGCTTGTGTGTTTCTG TCAAGGTATGTAAGGCGGGT 420 BY893358 BY896724
CJ051109_Contig6874 gSNP06942 ATCCATTAGGTGAGAGCCGA CGATGGAGAGCGGAACATTA 538 DC431908 BY881794 BY882538 BY893372 BY894997
CJ051109_Contig6877 gSNP06945 CGTTCCATGGATTGACTGGT TCCAAACAATAATAATCCCAGAA 424 BY893377 BY893560
CJ051109_Contig6915 gSNP06961 TCTGGCCATGCAATTGATTA TGGCTGTTGGTCTATCACGA 524 BY893237 BY895400 BJ936689 BY893545 BY891673 BJ939767 BJ937751 BY893493 BY895797 BY895894
CJ051109_Contig6917 gSNP06962 GCTAAGCTGTGATCAGGCAA GCCACGTCTAGGAATGCTGT 431 BY877958 BY893551 BY888472
CJ051109_Contig6925 gSNP06965 GTGGTAGGGTTTGCCAGGTA CCAAGAGCACTCAGCAAACA 526 BY893571 BY881307 FY231717
CJ051109_Contig6928 gSNP06966 TGGTTCCATGTTCACGTTCT TTAAAAGGCAAGCACATTTGG 405 BY893589 FY228103
CJ051109_Contig6936 gSNP06972 GGGATAGCAACTGTGGCATT GTCGACAAGGTTGGCACTCT 509 BY893642 FY233939 FY230400 BY894358 FY232507
CJ051109_Contig6946 gSNP06977 TTCCTCCCTCTGAAAGTCCA AATCCCTAGATGCCGTCCTT 420 BY893685 FY228919 FY231896
CJ051109_Contig6958 gSNP06981 TTCTCAGCAAACACCACTGC CCTGGCCATTGTATTGGACT 578 BY893725 FY227616 BY881156 BY890627 BY881690 BY880016
CJ051109_Contig6960 gSNP06983 GAGTCGCCACTCTACCAAGG CACGACCCTGGGTATCATTT 514 BY893730 FY231068 FY226923
CJ051109_Contig6966 gSNP06986 TTGCATTATATGTCGGGTGG TCAGAGCTGAACCTGCCACT 500 BY893751 BY894046 BY894262
CJ051109_Contig6967 gSNP06987 TTCAGTTGAAACCCTAATTTGAAAC CCTGACTGCCCCTCAAATAA 400 BY893754 FY226705 BY895850
CJ051109_Contig6979 gSNP06992 GGGTCAGCAATGGAGTCTTC AACACAACCCGAAGGAAGTG 494 BY881678 BY893826 BY878634
CJ051109_Contig6981 gSNP06993 ATTGCCGCCATATTTACGAG GAACCACCCCAACTTTCCTT 485 BY882277 BY893829 BY885379 BY884590 BY884700 FY228209
CJ051109_Contig6982 gSNP06994 GGTTCGAATCAGAAGTGGGA GTCCTTTGTGCAAAACCCTG 440 BY893839 FY228695 FY228201 FY236357
CJ051109_Contig6998 gSNP07001 GTTTGCGGCATTTATGGACT CCGTACACTGCAGTTTCCTTC 506 BY893905 FY235453 BY892757
CJ051109_Contig7000 gSNP07002 GATGTTCACAGGGTGACGTG TATACCCTGGAGGAGCAGGA 497 BY893910 FY234940
CJ051109_Contig7002 gSNP07004 GCAGGGCTTAAGGGTTTTTC TACCTGGCCGTTGTTTTACC 537 BY891288 BY893914 FY228576 BY883767
CJ051109_Contig7015 gSNP07009 TGCAGCTTAGACGAAACCCT GGCATTTGATGGCGACTTAT 497 BY893977 FY231111
CJ051109_Contig7027 gSNP07013 GAAGCACCACCCTTGACAAT GTTGACAGGGAGTTTGCCAT 519 FY232287 FY227045 BY894055
CJ051109_Contig7065 gSNP07030 GCCTAGAAGTTGCCTACCGTC CAATGCCTCTACGAAGCTCA 403 BY894178 BY886295
CJ051109_Contig7071 gSNP07033 CAAGAAACAATGGAAGCCCT ACTCTTTCGCTTTCTTCCCG 535 BY894198 DC430026 FY231718
CJ051109_Contig7076 gSNP07035 CGTCGGAGATCTCAGGAAAG CCCCTTTGATAGGTTTATCCG 567 BY894224 BJ938591 BY888018 BY896432 FY232363
CJ051109_Contig7079 gSNP07037 GCTCCCGTGACGTTTTAGTC GAGCCCCTTCATCATTCTCA 593 BY894228 FY225623 BY892383 BY885500
CJ051109_Contig7084 gSNP07038 GCAAAACCAAACCAGCAGAG GTTGGTCCATCAGCCATTTT 506 BY894238 BY891442 BY891224
CJ051109_Contig7101 gSNP07042 GGCTTCAATGTTAAGCAGCA TTCGAACAGTGCTCCATCTTT 474 BY895461 BY894336
CJ051109_Contig7102 gSNP07043 TGCAGTGCATGTGATTTAACAA TCAACGCCATTTAAGTGCAA 534 BY894344 FY228426 BY889348
CJ051109_Contig7114 gSNP07049 GATTTGTAGTTTGAGGCGGC CCCCATTCATCATCATCAGA 515 BY894399 BY878189 FY227827
CJ051109_Contig7119 gSNP07053 GACTGAGTCTTCGCCGAAAT ATCTGGCCGCATAATTTTCA 424 BY894421 BY894596 BY890876
CJ051109_Contig7125 gSNP07055 GTTCCAGGGAAACGTTTTGA ACAATCACACCCCTCCACAT 530 BY894438 BJ938922 BY884875 BY892425 BY882791
CJ051109_Contig7140 gSNP07060 AGCTTTGGAGTCTTGGGGTT GGGTCGGGTCATGAAGTAGA 418 BY894516 AU299145
CJ051109_Contig7145 gSNP07064 GGCGAGGTGCAAGAACTAGA CCAAACCGAACACAGGACTT 499 BY894547 BY885621 BY894918 FY227040
CJ051109_Contig7149 gSNP07065 TTTTGGGCATTGTGTAGCAG TGATTGACATCTCTGGCAGC 536 BY894567 BY893838 BY884106 BY887337 FY225991 FY227551 FY229135 FY235898 BY888253 BY896084
CJ051109_Contig7156 gSNP07069 AGCGTTATTTCCGCAGTGAC GAGCTGGCTTTGGGTAATGA 512 BY894594 BY878099 BY886593 BY893197
CJ051109_Contig7158 gSNP07070 CCCATAAAATTCCCCTCACC GCAAGCGCTTAAGGAGAGAA 500 BY881275 BY879786 BY894610 BY888850 AU083893 FY229213
CJ051109_Contig7180 gSNP07081 ACGATCGGTTTTTGATTTTCC ATGAAACGAGTGATAATGCTGG 400 BY894725 BY891063
CJ051109_Contig7186 gSNP07085 GCTCAGTTTTCCGTTCCTTG GCAGTCCTACAAGCTCCTGG 445 BP176128 BY894740 BY890346 BY890058
CJ051109_Contig7188 gSNP07086 ATGGCGTATGAGGATTGAGG GCTATTCTTGGCATCCAATTC 511 BY894742 BY889663 BJ937717
CJ051109_Contig7206 gSNP07093 TGTGCTTGCTGCATTTTCTC CTGTCTGCCTTCCTCCTTTG 570 BY894334 BY894842 BY889687 BY887732
CJ051109_Contig7216 gSNP07097 AGCCGCTACAGAGCTCAAAA GTAGGGCGACGCATAAAAAT 448 BY894883 FY231623
CJ051109_Contig7220 gSNP07098 ATGTGTGACTGGAGCGAGTG TTTTCTTGGCAAAATCCCAG 515 BY894899 BY880792 AU300171 BY888516 BY889303 BY894160 BY894116 BY886219 BW996503
CJ051109_Contig7240 gSNP07101 ATGGGCATGAGATTCAGAGC TTGCCTTTATGGCCTCTGTT 450 BY895005 BY892805
CJ051109_Contig7260 gSNP07110 TATCAGCGCATCAAATGGAG ATCCTCTGGTCTTTCCCAGC 312 BY895075 FY227144 FY235975
CJ051109_Contig7274 gSNP07116 GGTTGGTTTGTTTTCGTGCT ACAGGGCCAATGTTCAGGT 485 BY895143 DC432614
CJ051109_Contig7283 gSNP07119 CTATCAGGCGTCACCAATGA GCAGGCGATTGATGTGTATG 585 BY887517 BY895186 FY228432 AU083934 BY891328
CJ051109_Contig7288 gSNP07121 GGCGCTCTCATTTGCTTCTA CCGCATCCTCTGTATCTGCT 314 BJ939041 DC431164 BY895203
CJ051109_Contig7294 gSNP07122 AATGATGACCCATTTGCTGC CCAAACTCGGTCACCTTCTC 444 BY895241 FY229143
CJ051109_Contig7297 gSNP07123 AGGCAGTCTGTAGCTGGGAC ACTTGCTTGTGTTTGCGGTT 507 BY895250 FY228216 BY895697
CJ051109_Contig7310 gSNP07125 GGGTTGCATGGAGCAGTTAT TATGAGGGTAACTGCCAGGG 423 BY895315 FY227377
CJ051109_Contig7318 gSNP07128 GAAGCTTGCTTTTTGCCCTA GTACCATCGACTCCAGGCAT 472 BY895344 FY227347
CJ051109_Contig7324 gSNP07129 TATAAGAGCAGCCCTGGCAT CCTCAAAACAAACATACCCACA 507 BY895360 AU299319
CJ051109_Contig7325 gSNP07130 CAGCTCAAGCGAAAAACTCC TACCCACAAGTCCACAGTGC 515 BY895361 FY231620 FY225572
CJ051109_Contig7333 gSNP07131 GATTGGGAAAAGCTGTGAGC ATTGTCAGTCCTTCCAGGCA 394 BY895403 BY879089
CJ051109_Contig7338 gSNP07134 ACTGTTGCGCGTCAATTTTT AGAGGTCGAAGAAGAACCCG 435 DC431673 BY883468 BY895432 AU083782
CJ051109_Contig7343 gSNP07136 GTAATGGCATGGCGATCTTT AATTCCTTTGAGCCCCAACT 552 BP176432 BY879539 BY895444 FY232757 FY228748 BJ937506 BJ936777 BJ938832
CJ051109_Contig7356 gSNP07144 CTACATAGCCACCCCAGGAA ATCTCTGGTTCCACAATGGG 507 BY895520 BY878821 AU299157 BY882255 BY892320 FY225773 BY890285 AU299134 FY232493 BW993740
CJ051109_Contig7358 gSNP07146 TCTCTGGCCCATCTGATAGC GCCTTGAGCCTTGAGTTTTG 548 BY895524 BY882687 FY228927 FY229615
CJ051109_Contig7377 gSNP07153 GGAGCTGTTTTCACTGAGCC GCAGAGCTTCCTTAACACCG 475 BY895600 BY885148 BY894188
CJ051109_Contig7378 gSNP07154 GGATTTTCAGGGCTGGTTTT TATTTGCTCAATCATGCCGA 510 BY895602 FY230209 BJ937490
CJ051109_Contig7407 gSNP07161 GATTTCATCATCTTTAAGCCAGA TGTACTCCACCGAAACCACA 468 BY889720 BY895726
CJ051109_Contig7425 gSNP07165 GGCCACCGGAATCTATTACA AAGAGCTCGTGAAGCGTAGC 486 BY895781 BY891150
CJ051109_Contig7427 gSNP07167 CAGGGAAACTGCAAAGCTCTA GTTACGAAAGGCGGCCAAG 500 BY895783 AU084412 FY230971
CJ051109_Contig7440 gSNP07172 GTTGCGCTTTTCTCACACTG TGACAAAACCCTTTTCCACA 500 BY895834 FY233756
CJ051109_Contig7443 gSNP07173 GGTCACAGGCCATCGTAACT TACCATCTTGGCCTACGCTT 522 BY895851 BY893925 FY230524 BY891492
CJ051109_Contig7445 gSNP07175 CAGGGTTTGGTCATCTTTTCA AAGCTAGGCTTATCCCAGAACC 454 BY887985 BY895855
CJ051109_Contig7456 gSNP07180 TCTCAGAGCAGAATGCGAGA TTCCTCTGCACAGCATGAAC 508 AU066429 FY236056 FY231757 FY229599 FY232267 BY895903 BY887926
CJ051109_Contig7457 gSNP07181 CGTCGTTATCAACCCTGGAT CTCGCTGACATAGGCTAGGG 516 BY888522 BY882365 BY895905 BY889562
CJ051109_Contig7463 gSNP07183 ACTGTGCTAAAAGGGCGAGA TAAGGACCAAGGGAATCGTG 564 BY895953 BY890976
CJ051109_Contig7465 gSNP07184 TTTTCTAGGTGGTGGTCAGGA CTGCCCTGTCTCATCATCG 502 BY893488 FY234663 BY895963 FY229066 BJ938596
CJ051109_Contig7468 gSNP07186 CAGTGTCAGTGATGCAATCTG CGATGCTGAGGAGTGCAGTA 404 BY895970 FY228390
CJ051109_Contig7475 gSNP07188 GGATTGTGGACGAAGAAAGC CTTTAAACTCCGCCGCTATG 477 DC431807 BY884505 BY878566 BY896000 BY891548 DC430466
CJ051109_Contig7508 gSNP07200 TTCTTCGGTCTGCACTCCTT TCAACACATTAACATCCAGCTTC 464 BY896128 FY229007 BY887813
CJ051109_Contig7518 gSNP07205 TTTTCCGCAATTTTGGACC AAAGCCTCTTCCACCAATCC 401 BY896159 BY892638
CJ051109_Contig7536 gSNP07214 AAGGTGTGAATCCATGAGCTTT GAATGCCTCTCTCAAGCAGC 388 BY884881 BY896264
CJ051109_Contig7538 gSNP07215 GAAAGAGGCTTCTCTTTTGGC TTACCCCTCTGTTGTCCTGC 527 BY893531 BY896270 BY883153
CJ051109_Contig7539 gSNP07216 CGGTCCCCCTTACAGTTTTT AAGAACGAGTGGTGAATGGC 513 BY886470 BY880668 BY880669 BY896273 BY890353 BY890425 BY885774 BY895976 FY229358
CJ051109_Contig7580 gSNP07231 TGCTCCTAATCCCACACCTC AGGGTATCAAGCCGGTTCTT 538 BY896457 FY225742 BY894433 BP176315 BY895131
CJ051109_Contig7589 gSNP07234 TCCATGGTTAGACGCTGAAA GCAGGACAATGTTGGTGATG 481 BY896509 BY896499
CJ051109_Contig7602 gSNP07239 GGGTTTTTAGGGTTTACTTTTGG GCAGCATCATAAGCCCTAGC 336 BY896572 BJ939556
CJ051109_Contig7647 gSNP07253 CCTGAGAACACCCCATTACC TTAAAGGGCTTGTTCATGGC 505 BY881553 BY896779 BY894416 FY226553 FY234013
CJ051109_Contig9799 gSNP07255 TCAAGAGAAAAGGCCAAGGA TCCCCAGATATGAATCAGCC 341 FY225487 BY888848
CJ051109_Contig9815 gSNP07264 GTGTTCCAAGAAAGGAAGCG TCCCATGGCAGATAAAACAA 430 FY225558 FY234895
CJ051109_Contig9823 gSNP07267 ATTCTGGGGCTTTCCATTTG CCACAGATAAAACATACCCATTAGT 412 FY225585 BY894813
CJ051109_Contig9825 gSNP07269 TTTGGGTTTTCCTGTGGGTA TCTGAAAGGGCATCTTCGTT 456 BY886054 FY225599 BY888379 BY891017
CJ051109_Contig9826 gSNP07270 AGGTAAAAGGCGAAACAGGC CCTTAACCTCATCCCCCAAT 433 BY883861 FY225603 FY234315
CJ051109_Contig9827 gSNP07271 TGATCCTTTACGTCGGTTCC TCATCTTCTCCCTGTTCGCT 441 BY882201 FY225608
CJ051109_Contig9831 gSNP07273 CACGGCAACCATCAAATACC GCCTGCGAAAGAGGTTGTAA 496 FY225634 FY236282
CJ051109_Contig9844 gSNP07281 TCTTGGCGCAGAAACAGATA CAGGCAAGGCTTCATTGATT 415 FY225675 BY896218
CJ051109_Contig9849 gSNP07283 TTTTTCAATGTGAATGGGCA CCAAACACCTTTGCTGGAAT 358 BY879577 FY225696 FY227195
CJ051109_Contig9860 gSNP07291 GCCCAGAATCATAGAGCCAA TCCAATGCAGGATAAAAGCC 496 FY225748 FY232111
CJ051109_Contig9865 gSNP07295 TGGGATTATTTTAGGGCTGG TGATCTCCTCTTCGATGCAA 519 FY225769 FY227689 FY234708
CJ051109_Contig9866 gSNP07296 AGGTCCCTTCAGCAGCAGTA CCATTTCTGGATTCCGTGAT 433 FY225780 FY228220 FY230411
CJ051109_Contig9893 gSNP07312 CCGTGGGAGATTTAAAAGCA CCTCCAACTTGGGATAAATGA 416 BY893424 FY225927 FY227565
CJ051109_Contig9941 gSNP07330 AAAAACCTCACCAAAGCCCT TGCAGAGCTGATGTACGAGC 540 DC430829 BY879509 DC431005 FY226100 FY227846 BY883866 BY890817
CJ051109_Contig9943 gSNP07331 CTGTGAAGGATTGCTCACCA CCTTCTGACTAAAAGTGTTGGC 457 FY226103 BY888061
CJ051109_Contig9946 gSNP07332 CCATTCTGATCAAATCCCCA CAACATCGTAGAACACTGGAATG 421 FY226113 FY227181
CJ051109_Contig9951 gSNP07334 GGATACGCGTCGAGAATGTT TTTGTAGGAAAGTGACGGGG 527 FY226125 FY232307 FY231920
CJ051109_Contig9953 gSNP07335 CCTGGGGTACACCCTTTTCT CCCTGGTTTTGGTACAGCTC 502 FY226134 BY885781 AU299349 BY883635 FY229350
CJ051109_Contig9964 gSNP07337 ATTTTCCAGCAACCCATTTG GCCTCTCTTCCAGCTTCCTT 477 BY895235 FY226192 FY226051 FY236164 FY229070
CJ051109_Contig9968 gSNP07340 TTATTATAAGAGAATTTTGGCCGC TGTGAGTCGACAAACGCAG 401 FY226207 AU066461 AU066460
CJ051109_Contig9970 gSNP07342 TCTACCGTCTTTCCTCTCCG AAACCCCACACCAAACTGTC 443 FY234706 FY226213 FY227771 FY226632
CJ051109_Contig9978 gSNP07346 CCCACAGCCTAAATTCTCCA GCTTTGAAATGGCTGGTGAT 533 BY885619 BY883584 FY226236 FY230109 BY896774 FY236185 FY232583 FY226769
CJ051109_Contig9981 gSNP07348 TGGTTCACCGATTTGGTTTT GGAAAAGACGCCCAATATGA 419 BY885860 FY226243
CJ051109_Contig9983 gSNP07349 CAAAGCAAGGAAGGCTATGC AGCGCCAAATTCAACTGTCT 400 BY887180 FY226251 BY895775 FY227550
CJ051109_Contig9986 gSNP07351 CTTTATTTCCCTTCCCGACC ACCTCCACCTTGGTGACATT 344 FY226267 FY233659
CJ051109_Contig9996 gSNP07353 GAAATGGGCAAGAGCAACAT GATTCGCATTTTCCTTTCCA 494 FY226308 FY227242
CJ051109_Contig9997 gSNP07354 CCTTTAGAGGGCCTTGATTG TGTAGAGCTTCACACCCACG 512 FY226309 FY229862 BY889659
CJ051109_Contig10001 gSNP07356 GGGATAATTTGTAGGAGTGCTCA TGTCCCACATGCTCATGACT 572 FY226336 FY230131 FY231196
CJ051109_Contig10019 gSNP07367 GCGGCGTTCTGAAAATAAAA AAAATTTGCTTTACAAATGTTGAGA 406 BY884004 FY226404 BJ939490
CJ051109_Contig10036 gSNP07369 TCAATTTGGTGCAGATTTGG ACTCGAAAAGAGTGGCAACG 468 FY226453 BY880871
CJ051109_Contig10041 gSNP07372 TCAATTGGACTCGTCAGCAC CCAAAGCCGAGGAAGAATAG 440 BY890195 FY226472
CJ051109_Contig10049 gSNP07377 CAGGATCCCATGAAGATTCG TAACATGAAGTGGGCACCAA 582 BY884639 BY896737 FY226510 BY880724 FY229881
CJ051109_Contig10052 gSNP07379 TCATAATACGCGGCTGAAAA AAGCCATCTTGCCATGAGTT 492 FY226521 FY226546
CJ051109_Contig10056 gSNP07382 CCGCGTTACTGAACCAAAAT AAACATTTGCGAATTCTCGG 422 AU084834 BY878943 FY226537
CJ051109_Contig10076 gSNP07388 TTGTGGTCAGAGGCATGAAG ATTTGATGGAACTGGCAAGG 435 FY226617 FY234812
CJ051109_Contig10077 gSNP07389 GCTCTGCTCTACGGTTGTCC GAATCGCAGAGCTCCTCATC 578 FY226630 FY225496 BY891666 FY231167 BY888174 BY890821
CJ051109_Contig10088 gSNP07396 TGCTTCTCTTCCTCGCTCTC GGTTCGACATTAAGCCAAGC 500 FY226684 FY226619
CJ051109_Contig10089 gSNP07397 ATGGGTTTGAATGCCATCAT CAGTGAAGGTGCTATCAACCAA 493 FY226686 FY233648 BY885144
CJ051109_Contig10095 gSNP07401 TGCGGTAACATTTCAAGTCG ACAGGATGGGATCTTGCTTG 471 BY882735 FY226715 FY225704
CJ051109_Contig10101 gSNP07402 CGCGATTGTTACTCTGAACTG CGGACAGAAATTGAACAAACC 332 FY226746 BY884726
CJ051109_Contig10103 gSNP07403 TCGTCTCCCTTTCTTTGCAT CGAACAAAAACCCTCCTGAA 508 BY879183 FY226754 FY228077
CJ051109_Contig10112 gSNP07408 AACCAACAGGAAAAGCAGAGA AAAGTCTGCAATCGACAGGG 446 FY226767 FY228593 FY227329
CJ051109_Contig10114 gSNP07409 TTCTGGGTTATTGGGTTTGC ACATGTCCAGCATGAATCCC 515 BY887353 FY226772 BY894711 FY227491
CJ051109_Contig10115 gSNP07410 TTTTGATTTGATCGTGCCAA ATGGATATCCCCAGCCATCT 520 BY882581 FY226779 FY227608 BY892020
CJ051109_Contig10121 gSNP07416 CCAGAATTGGTTACGCTGCT GCACTGGATACATCTTTCTATCTCC 507 FY226800 BY885446 BY890615
CJ051109_Contig10127 gSNP07420 ACGTTTAGGTTGTCCGGATG GAAACGCCTAAGAGCTCCCT 511 FY226848 BP175639 BY888805 FY234529 BY880609
CJ051109_Contig10131 gSNP07421 GAGGCACTAAGCCCATTCAA TGAAACGTCTGGAAGAAGCC 341 BY880292 FY226867
CJ051109_Contig10134 gSNP07422 AGTGGCGAAGTTCCTTCAGA AGTCCAAGGTCTTGGCAGTG 512 BY878169 BY896197 FY226881 BY891800 BY881202 BJ940097 FY227433 BY896733 BP176098 BW992679
CJ051109_Contig10137 gSNP07425 GAACCCTCCATTTCAGTCCA TAAAGCCTCTCATTCAGGCG 501 BY886788 BY885031 FY226888 BY886698 BY886938 BY883895 FY234244
CJ051109_Contig10143 gSNP07428 TAGACAGGTTTCCCGAAGGG CTGGGTGAGTTTGCATGAGA 477 FY226927 FY225754 BY896138
CJ051109_Contig10148 gSNP07430 GAGACGCCCAAATAATCCAA TGAGAGCCCATTTCAGGAAC 564 BY878502 FY226952 FY226138 FY228312 FY225827 BY887699
CJ051109_Contig10155 gSNP07435 GGAAGGATTCAACCAAAAACA ATTCACGGAGATCTGGTTGG 421 BY885659 FY226981 BY895263
CJ051109_Contig10168 gSNP07440 TGGGGCTCTAGAAGAGTGGA CAGAGCGCCTTGAAAAGAGA 436 FY227067 FY229823
CJ051109_Contig10181 gSNP07446 GCAGCTTGGATTACTTGCCT AACAACAGGTTTTGAACAAAGGA 415 FY227168 BY888738 BY885814
CJ051109_Contig10182 gSNP07447 CCCTTCAAACCAGTCGAGAA AATACCCCTCCTGTCGTCCT 471 FY227196 FY232440
CJ051109_Contig10186 gSNP07449 CTCTTGGGCTTTTCTGATCG GCCATTGTAATGGTAGGGCA 446 FY227224 FY234111
CJ051109_Contig10192 gSNP07455 AAGGGCAATGTGTCCATGAT ATGCCACCAAAGTGTTCCTC 454 FY226435 FY235435 FY235923 FY227272
CJ051109_Contig10197 gSNP07457 AATGAAACGGTGCAATACCC GACCCACAGGCTCAGATGTT 421 FY227288 FY228911
CJ051109_Contig10222 gSNP07466 GCCGTGACGCTTTTACATTT TTCGCCTATATCATTTGGGG 553 FY227384 FY232257 BY879098 BY896213
CJ051109_Contig10226 gSNP07469 GCCAACAATCCGATTCTCTC TTCCATTCCAGACAAGGAGG 452 DC430804 FY227398 FY225944
CJ051109_Contig10227 gSNP07470 CCATTCATTCCATTGCACAG CAGCCTGCATCACAAACACT 508 DC431455 FY227400 FY232288
CJ051109_Contig10250 gSNP07481 GCTGCTGCAATGGAGAATTT TAAACTCCACAGGCAAAGGC 465 FY227516 FY225500 FY228739
CJ051109_Contig10252 gSNP07483 TTTGCTTTGCTCCAGAGGTT ATATTGGGCCAAACCACAAA 494 BY893515 FY227522 FY234963
CJ051109_Contig10256 gSNP07484 CCCACTTCACACTGAGCAGA CCCATAGGCCAAAATCATTG 400 FY227536 BY886049 BY881237
CJ051109_Contig10258 gSNP07486 ACGTCCTTTCTCGCTTGTGT AAAACTGCAGGCAGTCATCA 500 DC432322 BY882248 FY227538 BY881482 BY885475 BY884038 BY887947 BY892540 BY894167
CJ051109_Contig10263 gSNP07489 TTTTAGCTGGACTTGTCGGC CAATTACGGCATGGGAAAAG 505 BY892800 FY227555 FY230620 BY890447
CJ051109_Contig10272 gSNP07492 TGCCCCTAAATCATGAAACC TCATGCTCAGATTCACCTGC 437 FY227579 FY234568
CJ051109_Contig10296 gSNP07502 TTTTGTCATATTGTGGCGGA TGCTATTGTTGCTCCCACTG 308 FY227668 BY884980
CJ051109_Contig10303 gSNP07505 ACCCTGCAAACTCTGAGGAA ACCGAGCATAGAACCCCTCT 430 BY887713 FY227692
CJ051109_Contig10310 gSNP07510 CACACTTTCCACCACATTGC CCGGGTAAGAGGTCAGTCAA 527 FY227727 BY885776 BY884748 FY226522 FY229306 BY896102 FY232741 BY880838 FY236087
CJ051109_Contig10332 gSNP07519 CCTGATACATGAATCGCCAA ATCATACCCGTTTAAGGCCC 471 BY881692 FY227824 FY231799
CJ051109_Contig10334 gSNP07520 TGCTGCATCCTTACACTTGC CAGTTGGGATTCTCCATCGT 575 FY227829 BY892803
CJ051109_Contig10336 gSNP07522 GGTTTCTGCAACTGGTTCGT CTACTGCAACAACAGCCAGG 517 FY227835 BY885314 BY892305 FY227315
CJ051109_Contig10345 gSNP07527 CAGTGGCAAAAATTGGACCT CAATTTGTCAGCCCAGTTGA 442 FY227874 FY226817
CJ051109_Contig10351 gSNP07531 ACCAGCTAAGGCAAAGCAAA GCAAAATAGGGGCTGCATAA 453 FY227901 BY894123
CJ051109_Contig10355 gSNP07534 TGCATGCACACACAGTATGG CTTGGAGAGGAAGCAACTGG 410 FY227934 FY225658
CJ051109_Contig10357 gSNP07535 ACGAAGGGCCCATATTGTTT TCAACAAAGATCCAACGCAG 496 FY227945 BY880008
CJ051109_Contig10359 gSNP07537 TTCGACCGAGGAGAATTTTG ATAAGCCACAGCACAAGCCT 551 BY883764 FY227952 BY880567 FY232266 BY879095
CJ051109_Contig10363 gSNP07540 TCGTGCTTAATGCAGGAGTG GATGGGGTTGCTTCTTTTGA 553 BY881289 FY227968 FY234320 BY888064 BY885243 FY227439
CJ051109_Contig10371 gSNP07542 AACCTCAATCCTTCTGGGAAA TTTGCTGTTGTTGCTGTGAA 484 BY882183 BY887856 FY227994 FY233026
CJ051109_Contig10379 gSNP07548 TTGTGAAGTATAGTTTGATTTTGTGC ACCCTGCAGCACTTTTCTACTC 400 FY228016 FY231807
CJ051109_Contig10380 gSNP07549 TTGCGCTGTGAATAATATTTCG GCATGAATTTTATTTGGCCC 555 FY228030 FY228625 BY882960
CJ051109_Contig10396 gSNP07554 ATGCCTTCCCATAGGTTTCA ATCTCCAACGATTGGTCCAT 447 BY892161 FY228091 BY894153
CJ051109_Contig10402 gSNP07558 TCTTGTAGCTCAACATGGCG GCCCGAGAAGTCATTCAAAG 303 BY883627 FY228106
CJ051109_Contig10406 gSNP07560 CGGATTCTCCGTCAAGAAAA TGGTACATATTTGCCCCCAT 450 FY228112 FY232324
CJ051109_Contig10419 gSNP07567 TTTCGTGCAGTTTCATCAGC TAGGGCTTGAAGCTGTGGTT 420 FY228163 FY236690
CJ051109_Contig10438 gSNP07576 GCAATTGTGTTCGCTTTCAA TCCCTTGCTCTGTATGGTCC 499 AU083798 BY885986 FY228254 BY885447
CJ051109_Contig10442 gSNP07580 AATTTGTGCACAGTTTGGGC TGCTACTGCCACCTAATCCC 453 FY228281 BY879174
CJ051109_Contig10447 gSNP07583 CCCTAGCTTGTGAAGGCTTG AGCACCCAATATGCGTCTGT 466 FY228302 FY234737 FY229385
CJ051109_Contig10450 gSNP07584 GCAGTTTGAGTAGCTTGGGC TCCAAAGCCCTTGAAATCAC 520 FY228322 BY887440 BY895881
CJ051109_Contig10456 gSNP07587 CAATCTGGGAAGAACTCGCT CAGTGCATTGCCTGATTCAT 454 FY228339 BY887834
CJ051109_Contig10463 gSNP07589 ACAAAACAAAAGCACCCACC CCCATGGGCAAAGTTACAGT 500 BY887961 BJ938155 FY228380 BY885675 FY236330
CJ051109_Contig10465 gSNP07590 TCAAAGCAGGACAAGGTTCA TCCAGCAATGAGAATTAGGGA 314 FY228389 FY228309
CJ051109_Contig10476 gSNP07599 TACAATTGGTCAAATAAAATTTACAGG GCAAATAGGTCTCCGCAAAA 500 FY228434 DC430284 DC430296
CJ051109_Contig10479 gSNP07601 AAGTAGAGAGCAATGGCCGA AGCCATCTCGCTCGTAGGTA 501 BY885327 BY879206 FY228456
CJ051109_Contig10483 gSNP07604 TCGTTGTGGACATTGGTCTC CCACAATCGCCTTGATTCTT 455 BY885162 FY228474 BY891433 FY234028 BY894871
CJ051109_Contig10484 gSNP07605 TCAGACAATCTCATTTTAAGGCA TTCCTACCAAGTCCAACAGGA 508 FY228476 BY879356 BY894401 FY227304
CJ051109_Contig10512 gSNP07618 CAGCTTCATCCTTACGCACA CCGTAGTTTTCCAGGCAGAG 462 FY228647 FY228242
CJ051109_Contig10514 gSNP07619 TGGGCATGAAGATCTGTGAA CGAGATTGATGGGCGAGTAT 531 FY228660 DC430513 AU036772
CJ051109_Contig10515 gSNP07620 CGCGTTTCCGTTATTTCTGA TCGATCCTCAAAACCCTGTC 510 DC431733 BY880878 FY228662 BY889676
CJ051109_Contig10517 gSNP07621 TGAGTTTGGGATTGGGATTC TGCCAAACCTCTTGAGCAAC 522 BY891092 BP176443 FY228675 DC430283 DC430281
CJ051109_Contig10519 gSNP07623 CCCCAAAATGGCTGAAAATA TTCTGAATCGCTGAGGCTTT 501 FY228681 BY895372
CJ051109_Contig10521 gSNP07625 ATGCTGAGGTGCCTTATGCT AAGCCCAGATAAGCCCAAAT 494 AU084387 FY228686 FY229015 FY226492
CJ051109_Contig10526 gSNP07630 ACCCTAGTAGCATTGGCAGC GTAGGAAACCCCTGCACACT 509 DC432038 FY228711 BY878788 FY229107 FY234793 BY883799 BY896098 FY228301
CJ051109_Contig10528 gSNP07632 ATGGCCATTCTGAGGTTTGG GCCCTTTCAAGGGACCTGT 401 FY228718 FY228133
CJ051109_Contig10532 gSNP07635 CGTGACGAAATAGCGACGTA CTCATTTCCGCTGACAACAA 533 FY228730 FY232585 BJ938536 BJ937842
CJ051109_Contig10540 gSNP07639 CAATCCCAGCTCCAATGTTT TCGAGTGGTTTGGGAGAATC 311 DC430566 FY228760
CJ051109_Contig10547 gSNP07642 GGTTGAAAGAAGCTGGATCG TCCGAAGGGGTTTTACCATT 436 BY880469 FY228774
CJ051109_Contig10549 gSNP07644 TAGTGAGCGGCATACAGTGG AATCAAAGCGAATACTGCTGC 503 FY228784 BY890080 FY227505 FY236556
CJ051109_Contig10552 gSNP07645 TCTTCTCTCGCCGCTAACTC CAGGTGCAGAATTGAGCGTA 427 DC430708 FY228794 BY894931 BY890468
CJ051109_Contig10565 gSNP07653 TGATGGCAGCTTTTCACTTG TTGCTATTCACCAGCATCCA 420 FY228851 FY236068
CJ051109_Contig10568 gSNP07655 TCCGGAATCTCTGATAACAAAA TCATAGAAACGCCCACATCA 560 BY893816 FY228860 FY233290
CJ051109_Contig10575 gSNP07659 ACTTGGAATCTTGGTTCCCC AACAGGGTCTCATAATCGCC 501 BY886554 FY228882 FY229375
CJ051109_Contig10582 gSNP07662 GCCCTCAATTGACACTTCGT TAGATGGGCATTGTGCAGAC 314 FY228904 FY231820
CJ051109_Contig10591 gSNP07663 GCCATCTGAAGGGTGGAGTA AAGAATTGCGAGACAATGGC 527 FY228933 BY892714 BY883023 BY886771 FY228093 BY887917
CJ051109_Contig10594 gSNP07664 TAGCACCATGTTTCAAACCG TGATATGTGGTCAAATACTCAAAATTC 405 FY228938 FY236444 BY895452 FY234912 BY895840 BY880204
CJ051109_Contig10600 gSNP07667 GCAGCCCAATTAATTTTGACA GATCCTCCACCTCAAACTGC 448 FY228957 CLFL030_L04.f
CJ051109_Contig10617 gSNP07674 AGCGGAGTCAGAGAAAATGC TCTAGGGCATTAATTTCCGC 541 FY229019 FY226520 FY228176
CJ051109_Contig10619 gSNP07675 AGTTTTTCTTGCTTTGCGGA ATAAGCCAGAGTTTTCCCCG 476 FY229033 FY234363 BY878973
CJ051109_Contig10626 gSNP07677 GGCTCTCAAAGCTGCTGTCT CATCTTCACCACAGAAGCCA 481 FY229062 FY230008
CJ051109_Contig10628 gSNP07678 TGTCAGACTTGGACCAGTGC ACCATCAAGTTCCCAAACCA 439 FY229064 FY234692
CJ051109_Contig10633 gSNP07680 GCGAACCAGAGATAATCAGACC TAACCCGACAAATTCGAAGC 448 FY229089 FY229014
CJ051109_Contig10643 gSNP07685 AACTACCAGACATGGGCTCC GAAGGGATTGGAAGAGAGGC 447 FY229115 FY227919 BY894327
CJ051109_Contig10652 gSNP07689 GCGTGACGTGTAGGAAACTG CCAGCAGCATCAAAGACAGA 525 FY229154 BY890681 BY890770
CJ051109_Contig10654 gSNP07690 GGTGGTTCTAAGTATTTCAGGCA TGGGGATCAGCCAAAAGTAG 404 FY229167 BY889673 BY896377
CJ051109_Contig10655 gSNP07691 GGCTAGGAAAAGCTGCACAC AGAGACGCCCTTTGAATGGT 516 BY878906 FY229171 FY234412
CJ051109_Contig10657 gSNP07693 CACTACAAAGCCCTTGCCTG CCGGCAAGAACAATACCAAC 488 FY229175 BY895321
CJ051109_Contig10659 gSNP07695 TCAGAGTTCGATCCCTCGAT TTGATCGTCAACCTCAATGG 500 FY229178 FY234117 BY884600
CJ051109_Contig10674 gSNP07700 CCTGATGGGAGCAACAACTT GCCCTGCAGTTTTCATCTTC 551 FY229244 FY230717 BY880957 BY894584
CJ051109_Contig10675 gSNP07701 TAGCTGTGGTGATTTCTTTGTGA TGCTTTTCAACACCTAGCGG 477 BY895686 FY229246 FY229985 BY893281
CJ051109_Contig10697 gSNP07712 TTTAACGCTCTCTCCATCGC TGGTCGTCCAGAACAGACAG 371 BJ938805 FY229318 DC432351
CJ051109_Contig10700 gSNP07714 GTAAAGGTTGGTGCCCAAGA ACCAACAATGAGCAGTGCAG 360 FY229323 BY887503
CJ051109_Contig10702 gSNP07715 GCTTCCATCCCTCTGCAATA ATAACAGGGGTGCTGCTTGT 536 FY229330 BY887454 BY885786 FY227399 BY883826 FY226359 BY890597 BY885916
CJ051109_Contig10708 gSNP07719 AACTTGCTATTGCTGAGGGC AAGTGATCCATGCAAAAGGG 535 BY887754 FY229360 FY232180 FY231263
CJ051109_Contig10719 gSNP07726 AACTGTATCCAAAATGGGCG GCTGCTGTAGTTGGTGCAGA 437 FY229411 FY228013
CJ051109_Contig10721 gSNP07727 TCGAAAGGCTCTTCAACTTCA CGTTGCAGGATATGAATGCT 522 FY229415 FY227595 FY226575
CJ051109_Contig10746 gSNP07736 GAGACACGGCTGTCTAGGGT TGCAGATGGGTGTCTGAAAA 493 BY884047 BY896526 FY229548 FY235736 BY886512 BY878580 BY884857
CJ051109_Contig10748 gSNP07738 TTTACGTTTTGCACCTCTGC GCAGGATTCTCAAACTGTTGAA 529 FY229552 AU085020 BY895819 BY896562
CJ051109_Contig10756 gSNP07742 GGATTCACCGTTTTATCTTGAGG GTAGAAATGAAGCGCCGAAG 417 FY229617 BY893777 FY227628
CJ051109_Contig10758 gSNP07743 GGAGCTCTCTCTTGTGGGC CTTGTTTGTGCAAGCATTCG 505 FY229632 FY235287 BY878738
CJ051109_Contig10765 gSNP07747 TCTGTTCCATCACTCTGGACA ATGCGTCTGTCTTTTCTGGG 431 FY229664 FY232576 FY230413
CJ051109_Contig10767 gSNP07748 ATAGGCCCAGGAGAAAGGAA TGATCTGAGCCTTGTCATCG 521 FY229674 BY880758
CJ051109_Contig10768 gSNP07749 AGTAAGAACAATGCCGGTGC TGTGACACAGAGCAGTGCAT 405 FY229677 FY229784
CJ051109_Contig10772 gSNP07751 GGCAGCTTTGAATGAAGTCC GGGCGCAATAAAGAGACGTA 302 DC430521 FY229684
CJ051109_Contig10794 gSNP07763 CGTCTCCCTTCACAAAGCTC GCCCACCAGGACCTTTTAGT 409 BY885637 FY229781 FY232588
CJ051109_Contig10795 gSNP07764 CTCGGAATTTGGGTTCAAGA CCTCTAAACAAACCCTGCCA 312 FY229783 AU084270
CJ051109_Contig10798 gSNP07765 CTATCTGGGTTGTTCGGCAT AGATTGCTCCTCCAGCACAT 437 FY229794 BY890020
CJ051109_Contig10811 gSNP07770 TGAACGGCACATTCTCTGAA TCATCGTCTCCCCTATCGAA 410 FY229854 FY230384
CJ051109_Contig10817 gSNP07771 ATGCGTCAGCAAAGACAATG TGTGCCACTTTTTCCTTCAA 433 BY884226 FY229872
CJ051109_Contig10827 gSNP07777 TAAATGGTGAGGTGGGTGGT GAATCGGAATTGGGCTTACA 540 FY229922 BY885560 BY893008 BY885930
CJ051109_Contig10830 gSNP07778 GCTAATGAATTTTGCGGAGC AGACTATATCAGTTGGCCGGA 527 FY229950 FY235049 BY890381
CJ051109_Contig10835 gSNP07782 TCCACAGAAACGCTAAACCC CAGCCACTCCTCGAACAGAT 512 BP176617 FY229964 BY891614 BY893598
CJ051109_Contig10837 gSNP07784 AGAATGTGGGCGCAATTTAG TCCCATTTTCACTTCTTCCG 575 BY883683 BY892124 FY229969 BY882973 BY881756 BY890902 BY891449
CJ051109_Contig10838 gSNP07785 ATTTTGCACTCTGCAGTCCC TTCACCATCGTCCTCATCAA 498 FY229973 FY235793 FY234775 FY231135 FY234083
CJ051109_Contig10848 gSNP07790 ATGGCGAACTGCAAATTCTT TAGACCCTAAGCTCGCCAAA 553 DC431703 BY885536 DC430676 AU084385 FY230035 FY228251 FY236277 DC430004
CJ051109_Contig10857 gSNP07794 GCAAAATTTCGGAGCAAAAG AAGGGATTTGGGAATTGGTC 479 FY230083 FY227010
CJ051109_Contig10868 gSNP07796 CGTAGTGGCCCTAACCTCAA CTATGCCAAATGGAGCCCT 501 FY230141 FY228065
CJ051109_Contig10873 gSNP07801 GGCTTTTCATTTCCCTTTCC GAGAACGGTCACAGCACAGA 471 FY230168 FY227339
CJ051109_Contig10875 gSNP07802 TTCCGGAGGGATTGTTACTG TCTGTTTCTGCCTTTGGCTT 546 FY230186 BY886316 BY878176 AU299121 FY234726 BY895366
CJ051109_Contig10880 gSNP07804 CTGAAAGATCACTGCATCGG TCCTCAAAAAGGGCAGAAGA 358 BJ937893 FY230216
CJ051109_Contig10902 gSNP07813 TCCCATATTATGCAAACTCGG TTGCCCTCGTCTTCCTAGTC 509 FY230327 FY236666
CJ051109_Contig10908 gSNP07816 AGGATTGGCTGGCTTCTACA ATGGGTCAGCTAGCATTTGG 443 FY230353 FY225506 FY227878
CJ051109_Contig10910 gSNP07817 CGTGCTTTGGGGACATAGAT GGACACACCCACATGATGAA 456 FY230359 FY227468
CJ051109_Contig10913 gSNP07819 GCCTACTCCAAAACAAGCTGA ATACCAGCGATCCTTTCCCT 431 BY886902 FY230379
CJ051109_Contig10921 gSNP07822 GGTCCATTAGATGCGGAATG AGACGTTACTCGTCGTTGCC 491 FY230408 BY882405 FY227577
CJ051109_Contig10922 gSNP07823 CTGAAAAATCGCGAAACATAA CGAGATCTTTTAGCCAGCCA 496 FY230412 FY228790
CJ051109_Contig10925 gSNP07825 AATAAGGGGTCGGGTCTGTT ACTTCACGTCCAGGAAGCAC 443 FY230418 FY229008
CJ051109_Contig10938 gSNP07831 ATACCGTGCCGAATTCTTTG GAGATAGGATGCAGCCAAGG 504 FY230473 FY226692
CJ051109_Contig10943 gSNP07832 TTACTGCCCGCTCCAAATAC ATTGGAGCAGACACAGGTGA 531 FY230504 BY887049 BY883108
CJ051109_Contig10955 gSNP07836 CCCGCTTTCTTGTGTGTTTT ATCCTTGGGGACTGTCTGTG 572 BY879348 BY884545 FY230563 FY234029 BY880411
CJ051109_Contig10957 gSNP07837 ACATTGCAAGGAAAAGACCC TTGGGATTAGGCATTTGAGC 468 BY883471 FY230578 FY227557
CJ051109_Contig10961 gSNP07840 GCACTGCATCTACCCCTTGT GCAGGGTTGTCTTTCTCAGC 306 BP176021 FY230591
CJ051109_Contig10971 gSNP07844 TAGAAAATGAGGCGGCAGAC GCAACTCAGGGACAGACTCG 412 BP176555 FY230617
CJ051109_Contig10975 gSNP07845 CTCGAACCTTGCACCTCTCT TATTACGGCATTCTTTGCCA 512 FY230659 BY882144 BY891529 BY881010
CJ051109_Contig10977 gSNP07846 TGTTTTGGTTCATTGCCAGA GAGAAGTTGAGGGCGATGAG 459 FY230672 FY232294
CJ051109_Contig10983 gSNP07848 CTGCTGTAAATGGAGGAGGC TGCATTGACAAAACTCTGCC 499 FY230706 BY888799 FY229031
CJ051109_Contig10998 gSNP07856 CAATCTCCATGGACCCTTGT GTAGGAGGAACTTTTGGGGC 590 FY230804 BY885256 BY885136 BY881364 BY885697 BY894930 BY895811 FY231622
CJ051109_Contig10999 gSNP07857 CGATCAAGGTGAGGAATGCT CACATAACACAGCCGTCCC 453 FY230816 FY229515
CJ051109_Contig11000 gSNP07858 CCCAAAACAACATTTTTGCC TGCCATTAATCCTTTCCAGC 530 FY230818 FY235407 BY883258 FY230197 FY234194
CJ051109_Contig11005 gSNP07861 AATCCACCTCTGTGAGGCTTT ATTTATGCCTGAGGCCCACT 403 FY230861 FY228775
CJ051109_Contig11014 gSNP07866 GGCAGCAAAATGGAAGAGAA TGATGCTCCCACCACTGTAA 422 BY888523 FY230906 FY227938
CJ051109_Contig11028 gSNP07872 TATTTTGGAGGTCTGACGCC CGGGCAAATATTGGGTATGA 512 FY230965 BY889075 BJ939213
CJ051109_Contig11030 gSNP07874 GTTCCTCAGGTGGAAGGACA ACGATCCTGTTGGCAGTTTC 422 FY230973 FY226181
CJ051109_Contig11034 gSNP07876 TTGGTGCCTTTTCATGTTCA TCAATCACAGTGTTGGGAGG 467 FY230985 BY886078
CJ051109_Contig11045 gSNP07879 TCTCCGTCTGCTATCTGCAA AAATTCCCATTATCCGCACA 533 FY231041 FY227112 FY226003 FY234499
CJ051109_Contig11048 gSNP07880 TTTGCAGTCGTCTGCCTATG AAGAGCTTTGCGGTGGACT 522 FY231054 BY894036
CJ051109_Contig11065 gSNP07888 ACTAACCCACCATATGCCGA CATGGTACCGTAGCACATCG 495 DC430921 FY231127 FY227928 FY229915
CJ051109_Contig11079 gSNP07893 AACTCTAAGATGGCCCAGCA ATGGCACGAATCTGTTCCTC 521 FY231184 FY231825 BY895891 DC430156
CJ051109_Contig11084 gSNP07896 CTGTCGCCAGTAATGGGAAT TGAGAATGGCTACCTCGCTT 515 FY231198 FY233666
CJ051109_Contig11093 gSNP07901 CATGCTTAACCACGTCCCTT GCTCAAGAGCATCATCCCTC 499 FY231248 BY895253
CJ051109_Contig11094 gSNP07902 GATCGAATCCGTCGAGGTTA TTTAGGGTTTTCCCGCTCTT 467 FY231250 FY232950 FY229917
CJ051109_Contig11097 gSNP07905 CCATCTCTGAGAGGAAACGC CTGTTGCGTCCATTACCCTT 545 BJ939140 FY231298 BY889040 FY226400 BY891689
CJ051109_Contig11105 gSNP07907 CCATTACCCTTGTTCGTGCT TTAATAAGCCATCCCTGGCA 559 BY883459 FY231378 FY229331
CJ051109_Contig11107 gSNP07908 AGCGTGTCAGCCAATTCTTT TTGGGTCACTGAAGGAGGAC 524 FY231400 FY234246 FY234677 FY227779
CJ051109_Contig11111 gSNP07910 CACTAGCAATTGCAGGCACA TCTTTTTACCACCAATGTCATAGC 501 FY231456 BY895802
CJ051109_Contig11112 gSNP07911 CAGTTCGTTAGCATTGGGGT AATCCGTCATCCATGCTTTC 451 BY882679 FY231500 FY229902
CJ051109_Contig11119 gSNP07913 ATTTTGGAGCGATTTCGTGA TCGACAGACGTAAAAATTGCTG 500 FY231544 BY895978
CJ051109_Contig11126 gSNP07917 TGGCTAGGCCCAACATTTAG GATCAATTCCGTAGCCTCCA 522 FY231597 FY229372 BY892728
CJ051109_Contig11130 gSNP07919 ATAATCGCCGAACTTTGCAC AGGCTTTGTCTTCTGTGGGA 331 BY879898 FY231624 FY230380
CJ051109_Contig11133 gSNP07921 CCCGAAGACTTTCAAACTGG TGGACTGTTGGTGTTGTTGAA 430 BY878736 FY231642
CJ051109_Contig11136 gSNP07923 ATGACGATGAACGGTGTGAA GCACAAAAAGGCCAGAAGAC 446 FY231651 FY227701
CJ051109_Contig11138 gSNP07924 TGGTGTACACGAGAAGGGAA AAACCCCTGAAAATCCACAA 493 FY231658 FY226821
CJ051109_Contig11146 gSNP07927 AAAAGCCTCGAAACAGAGCA GAACCGAGCAAAAGAAGCAC 416 FY231705 FY233682
CJ051109_Contig11152 gSNP07932 TTCATGTCACCTTCTCTTTCACA AGATTTCCCAGACCCAGAGG 504 FY231756 BY885016 BY891357
CJ051109_Contig11155 gSNP07934 CGAAACCCGAATTCAGAGAC TCGGTATTGAGAGGATTGGC 401 BP176638 FY231765 FY227821 FY235056 BY895007
CJ051109_Contig11162 gSNP07935 CTGAAGATCAAGCAACAATGGA CCAATGGATGAGCAACAAGA 417 BY881235 FY231791
CJ051109_Contig11166 gSNP07938 GCAGGCTTCACTATGGCTTC TCCGTTTCTTATCACGGGTC 374 FY231806 BY887085 BY895224
CJ051109_Contig11168 gSNP07939 ACGGGCAAAATATCATCGAG CACCTGATTTATGCGCTCCT 547 FY231832 FY228120 FY228807
CJ051109_Contig11175 gSNP07942 TATTAGGCTTCACGGCATCC CTATCTGGCTCCTTTTCCCC 500 FY231864 FY226950 FY232942 BY886683 FY226059
CJ051109_Contig11178 gSNP07943 GGCTTCTCCTGTCAGCATTT TCCTTTTGCTGAAAAACCCA 512 FY231875 BY893278 BY895745
CJ051109_Contig11179 gSNP07944 CCTAACACCCTACATGCCCC TTCAAAATTTTTAGCTCTGGCA 405 FY231881 FY234411
CJ051109_Contig11181 gSNP07945 GCTTCTGTTCTTCGCCAAAC TTTTCGGCATCTATGAAGGC 571 FY231892 BY890825 FY233938 BY878171 FY236091 BY887794
CJ051109_Contig11188 gSNP07948 CGTTACTCTTGAATTTGCCCA GACAAACGTGATATCGCCAG 513 FY231907 FY227283
CJ051109_Contig11189 gSNP07949 TCCCCAAAATGGAGATAGCA GTAGGTTCCCCTGTTATGGC 422 BY889832 FY231910
CJ051109_Contig11192 gSNP07950 GGCTTAGCCGACACAACAAG CCCTAATCCCACAAAGATCC 523 FY231918 FY225918
CJ051109_Contig11198 gSNP07954 TGAGTGGGTCTTCGTCTGTG ATCATTGAAGTTTCCCAGCG 464 FY231940 FY225950
CJ051109_Contig11199 gSNP07955 ATTTTGCAAACGTCAATGGAT GTTGAATTCGTTCCGCTGTT 500 FY231949 FY228560 FY234841
CJ051109_Contig11214 gSNP07961 CCCGAAGTCGAGACATTCAT AGTGCGCGAGACAGAGTACA 570 BY887991 DC431264 FY232008 BY894052 FY227832 FY226129 BY896223 BY882891 FY231373
CJ051109_Contig11230 gSNP07968 AAGAAATCCATTCTGGTGCG CTTCAAGGGAAAGCTTGCTG 521 BY882195 FY232077 DC432617 DC430194 FY234586
CJ051109_Contig11231 gSNP07969 CAGTGGAAGTCACAGTAATCCG GCATCGGACTTACCCAACTC 506 FY232081 FY227741
CJ051109_Contig11236 gSNP07973 CTGAACTGTCGCTTGCATTG CCGGTCTTCTCTGTTCCATC 428 FY232095 FY225732
CJ051109_Contig11243 gSNP07976 GGTTGAAATCCAGGATGCAC TGAACCAACATGCTGAAGTGA 310 BY889902 FY232129 BY885747
CJ051109_Contig11245 gSNP07978 CCAGCGGGATGATAAGAAAA GTTCAAGAAAGTGTGCGGTG 489 FY232139 BW992733 BY885013 BY879963
CJ051109_Contig11251 gSNP07980 TAATGGCAGAGAAACGAGGG CATCCACCCCTAAAAACAGC 419 FY228433 FY232162
CJ051109_Contig11267 gSNP07987 CCGTCATAGACTGAGGGTCAA CCCTAAACCCAAATGTTCAAAA 418 FY232222 FY228259
CJ051109_Contig11271 gSNP07988 GATCTGGCAAAGCAGAATTT TACTGCTCAAAACAATAAATGCC 400 FY232246 BY880969
CJ051109_Contig11292 gSNP07996 CAATCCAATGGTCGAACCTC GGGTTTTTAGTGTCCAGGTGA 439 BY893010 FY232333
CJ051109_Contig11293 gSNP07997 CGCATTATTTCTGGTCGGTT TGGTCCTCCACCCATTTCTA 433 FY232342 FY234733
CJ051109_Contig11294 gSNP07998 TGCAATCCTCCACCATATCTC CGATTGGATTGGAAGTCTGAA 502 FY232343 FY232161 BP176642
CJ051109_Contig11305 gSNP08003 ATATTTTCAGCCCAGCCTCA CAGGGTGAAAAAGTTCCTGG 469 FY232385 FY234971 FY229747
CJ051109_Contig11307 gSNP08005 GCTCATCCACAAGGAAAGAAG ATGCCTAAACAATGCCCAGA 429 BP176680 FY232392 BY893178
CJ051109_Contig11314 gSNP08009 TCCTCTTTCCGATCTGCATT AGCCCTTGACAGTTGGATTG 551 BJ938587 FY232411 BY891130 BY896160 BY877923 BY881765 FY228820 FY234838 FY234686 FY233463 BY878818
BY895816 BY884946
CJ051109_Contig11327 gSNP08014 GGAGGGTTGAGGAATTTAGAGAA AGGGACCTGCAATCTCACAC 440 AU084232 FY232484
CJ051109_Contig11328 gSNP08015 ACTGAAAAGCGCTGGATTGT CCTCAACGTCTCTGATTCTGC 436 FY232505 BY890524 BY879826
CJ051109_Contig11333 gSNP08017 TGCTTGAGGGAAGTATCGCT GTCTGCAGCTTTACAAGCCC 524 FY232522 FY232658 FY230175 FY228893
CJ051109_Contig11335 gSNP08019 GTAGATGTTCCCGTTTCGGA CGAAACAAACTGCAAAAGCA 411 FY232531 FY234722
CJ051109_Contig11348 gSNP08027 AACATGAAATCTCGTTCCGC ACCTCACAAAGGCTCGAGAA 487 FY232574 FY229736
CJ051109_Contig11354 gSNP08030 GCAGATCCCCCAGTAGAGAA TTCGAAACCCTAGGCGAGTA 500 FY232587 BY889544 FY232893 FY235791
CJ051109_Contig11356 gSNP08032 AGTGCCGTGCTTTCTCATTT CTGGACTGCTGCTGCTTAAA 512 BP176465 FY232590 BY896469
CJ051109_Contig11359 gSNP08035 TAGCCTCCCAACACTCCATC AGGATATCTGGTGAGGTGCG 309 BY889866 FY232609
CJ051109_Contig11363 gSNP08038 CCGCCAATTTGTCAAGTTTC ACGTCTACTGTGGTGGGGAG 328 FY232621 DC430650
CJ051109_Contig11365 gSNP08039 ACTCCTCGCCAAATCTCAAA CTCCAGATTTCAATGGAGGC 485 FY232625 FY225921
CJ051109_Contig11368 gSNP08041 GTGGGCGCTAGGTTCTGTTA TGAGCAACAGCACAAAACAA 480 FY232635 BY878684
CJ051109_Contig11369 gSNP08042 AGTGCAGGTAGCACAGAGCA TACCGTTCTGACAAATCCCC 466 BY886559 FY232636 BY890734
CJ051109_Contig11372 gSNP08044 CGAGGATAGAATATGGGCGA GAAGCTTCTCGGTTGCATTC 380 FY232645 FY230795
CJ051109_Contig11375 gSNP08046 CCACTCTGCTCTAATCGCCT TTGGGTAATTCTGGAACGGA 478 FY232651 FY232675
CJ051109_Contig11377 gSNP08047 GGAATAGAAATGGCGTGTGG GACCTTGGTGCCATTGATCT 535 FY232664 FY236414 BY888452
CJ051109_Contig11381 gSNP08050 TAGTGCGCTGGGAGTAGAGC CCCACTTTTCTTCTGCCTGA 435 FY232680 BY896765
CJ051109_Contig11408 gSNP08060 CCAGCTGCATACGAAAATCA CTCGTTCCAGACAGCAGACA 460 FY232832 BJ939057 BY893025
CJ051109_Contig11414 gSNP08063 GAGGAGGACCAACAGCAGAG CATAACCCTGGCAATGACCT 562 DC431199 FY232881 FY226507 AU066425
CJ051109_Contig11416 gSNP08065 TGGAGGAATGGTTGGAGAAG GAGCAGCAGAAAGACAACCC 438 FY232898 FY233278
CJ051109_Contig11417 gSNP08066 ACGAAAGAGGAGCAGGTGAA CAAGGGCTTGCTGGATTTTA 581 FY232903 FY227589 BY880886 FY229699 BY879619
CJ051109_Contig11423 gSNP08068 TTGAATCTGTTGGATCCGGT ACCCTCCTCTTGCATCTCGT 577 DC432022 DC431652 DC430917 FY232931 BY894338 AU084607 FY233074 FY236171 FY231932 DC429866
CJ051109_Contig11430 gSNP08073 ACAGGTGGGTTCTATCCTCG AAAAGCACCAATTGGAGTGG 472 AU084313 BY894597 FY232977 FY228591
CJ051109_Contig11433 gSNP08074 ATATGAAATGGAGCATCGGC TTGATATGTCGTCCCCAATG 401 FY232996 FY232420
CJ051109_Contig11434 gSNP08075 ACTACTGCAAAAGATGGCCC TCGCTGTGACTCTCATGGAC 570 FY233015 BY879707 BY887565
CJ051109_Contig11439 gSNP08078 TTCATAATGCCAGGCACAAA GATTTCCGCAAGCAAATTCT 525 FY233048 BY885896 BY884214 FY225764
CJ051109_Contig11442 gSNP08080 TTTGAATACATGGGTGCCTG GGCCTAAGCAGCTCAAAATG 503 AU084144 FY233059 FY232211 FY228613 FY234734
CJ051109_Contig11446 gSNP08081 GACCATTGCTCACCCACTTT TTCCATACTTTCCACCCTGC 497 FY233090 FY234613
CJ051109_Contig11460 gSNP08088 GTTCTGAGCCATAGACCGGA GGAGTAATTCGGCCAGACAG 419 FY233264 FY234957
CJ051109_Contig11466 gSNP08089 AACATTCATTGCCCAGCTTC AGAGTTTGGAGGAACTCGGTC 500 FY233295 BY888622 AU299343
CJ051109_Contig11476 gSNP08095 AAGGCCTGTTTTGTTTGGTG CTCCTCCACAGCTTCAGTCC 534 FY233383 DC432689 DC430329 BW993004
CJ051109_Contig11486 gSNP08099 GCGTGTTCAGGGGTCATATC ACCACAGGAACAATTCCAGC 458 BY886561 BY894760 FY233474 BY879579 FY231715
CJ051109_Contig11487 gSNP08100 GCTGCCCTCCTACTGAGAAA GCAGTAACCAACCCTCCAAA 488 FY233528 FY230367
CJ051109_Contig11496 gSNP08105 TCAGCGAGCAGTGAGCATAC AGAGCAGAGAGAGCGTCAGC 524 FY233645 BJ938594
CJ051109_Contig11505 gSNP08110 TTTATCCAAAACCAGTCGGC GATTGCTTGACACGATCCCT 401 FY233731 FY228136
CJ051109_Contig11506 gSNP08111 CTTGGGACTTCTCCGTGTTG ACATCATTGCCCTGCTCC 400 FY233732 BY891986
CJ051109_Contig11517 gSNP08116 ATGCCTGCATGAGTGCTCTA TGTGACTTGGGTTTGGTCCT 516 BJ939737 FY233879 BY880342 FY236601
CJ051109_Contig11520 gSNP08119 TCTCACATTCCTCGCCTTCT GTGAAAGAAGGCCAAGCTCA 444 BY884521 BY879050 FY233900
CJ051109_Contig11536 gSNP08121 AACACCTTGCTGCAATACCC GTGATCATCCACTCCAGGCT 476 FY234014 FY232056 BY888584 BY879231
CJ051109_Contig11557 gSNP08137 GAACGCCATGGAAGATGAGT TTGCTACTCCATGACGCAAC 464 FY234115 FY230839
CJ051109_Contig11563 gSNP08141 AGATGAACCAGGATCGTTCG GGGTAACTTCTGCAGCCTTG 465 FY234123 BY889376
CJ051109_Contig11565 gSNP08143 AAACCTTGCCACTTCTCCAA TCCTCACTGGATCCTGACAA 542 FY234125 FY228407 BY890894 FY229560
CJ051109_Contig11566 gSNP08144 TTCGTCTGCTAGAGGCAAAAA TCAGCATGAACAAGCCTGAC 475 FY234140 FY229878 BY896237
CJ051109_Contig11571 gSNP08147 TGTCGATGTCCAGGAGTTCA GAGAGGGCCTCCATACTGC 593 BY884109 FY234159 FY227180 DC430392 BY891269
CJ051109_Contig11572 gSNP08148 TTCCTTTACTTCCAGGCCAA GGCTGTATATCCACCTGCGT 517 FY234160 FY226494
CJ051109_Contig11588 gSNP08154 TTGATCAGCGATCTGTCTGC ACCAACAGAACCACCAGCAT 498 FY234215 FY229827
CJ051109_Contig11589 gSNP08155 TGCAGGTAAGCGACAGTTTG CGTCGCCTCCTCTTTTCATA 480 FY234223 FY230320
CJ051109_Contig11595 gSNP08160 AATGGCAATTCTGGAGGAAA CTTTGCCGACAGACACACTG 422 FY234236 FY233314
Cj01C07_BB940579 gSNP08165 TAAAGGAGCCCCAAAATCG TCCAATCTCTGTCTGTGCATTT 238 BB940579
Cj01E02_BB940589 gSNP08167 TCAGATCAAGAAGTTGTAACGCA GAACCGTGCCCAATATGACT 262 BB940589
Cj01E10_BB940592 gSNP08168 CAACATGGCGTGTTTTGTTT AAATATCTCACGCGCTGACC 381 BB940592
Cj02C09_BB940614 gSNP08173 GCATTGCAGACTATGTGCGT CTTTGCCTTTTATTGCAGGG 355 BB940614
Cj02D04_BB940616 gSNP08175 TCAACGAGGTTTTTGTAAGGG AGATGACTGTCGTTGCGTTG 412 BB940616
Cj02G05_BB940629 gSNP08180 TGGACATGACAGTAGGGCAG CTATGGTCCAGCAGGAAAGG 380 BB940629
Cj03B07_BB940639 gSNP08182 CGGACTGCATACAAGGACAA TTGAAATGACCACTGCTTCG 248 BB940639
Cj03C01_BB940641 gSNP08183 CAAGGGAAACGAAACCTGTG AAAAACACACAAAGGCCTGC 445 BB940641
Cj03F01_BB940650 gSNP08185 CATGATTTCAATCAAGGGCA GAAATGCCATTGTTGTGGCT 329 BB940650
Cj03F10_BB940651 gSNP08186 CACCTCAGATGGAAATGCAG CATAGCATGAGCAAACGCTG 274 BB940651
Cj04A12_BB940663 gSNP08191 CGCTAAAAGCCAGCTGATTC CAAAACCAAGAGGCCAAATG 271 BB940663
Cj05D12_BB940711 gSNP08207 TGAGCGTCTTATTACGCCAAT ATGTATCCCATTCCCCAAGG 251 BB940711
Cj05E03_BB941195 gSNP08208 TATGGTTTCAGCCATGTGGA TGAGCCAAACCGTAGCTAGA 428 BB941195
Cj06B07_BB940730 gSNP08211 CCTCCGTAGTTGCCCACATA GACAGCAATGTTCATGGGC 291 BB940730
Cj06D05_BB940736 gSNP08212 GTCTGCCCCCAGTAAAGGAG TGTTCCGGACCAGTTAACATAA 201 BB940736
Cj06E04_BB940745 gSNP08213 CAGCAGTGAAGATGAAGCAGA GAGGGGCACCATCAAGTTT 327 BB940745
Cj07C01_BB940773 gSNP08223 TTATCATGGCTTCCAATGGC AAGCAGCAGAAAGAGGAGGA 290 BB940773
Cj07H11_BB940805 gSNP08230 ATTGCAAACAGCTCGCCTAA TCCAGGCATAGACAACTCCC 250 BB940805
Cj08A01_BB940806 gSNP08231 GACAAGCAGTTTGCCGAGTC GATGGTGACCTCCTCCAAGA 225 BB940806
Cj08A12_BB940811 gSNP08234 CACTTCATGGTGCAAGGAGA TCCTTCAGGATGAACATAAGAGAA 240 BB940811
Cj08B01_BB940812 gSNP08235 CATTTGGGTAGAAATGGATTTGA AAGCTAAGCGTTCCACACAA 263 BB940812
Cj08F08_BB940828 gSNP08239 TTCAGCAAATCGATGAGCAC CACTTCAGCCACTGCAACAT 336 BB940828
Cj09F04_BB940851 gSNP08246 GAAATGGATGGTGGACAAGG TTAAACTCGGGTTCTGCCAC 360 BB940851
Cj09H01_BB940860 gSNP08247 TGCTGTGGTGGAAAATCTTG GCCCGTGTTGTTTATGCTTT 304 BB940860
Cj09H07_BB940861 gSNP08248 CTCATGCTCAACGCTATGGT AATCCAGATGGATGAAAGCG 381 BB940861
Cj10C02_BB940870 gSNP08252 TTCCAAAATCCCCCACAATA TGAATCGCAAAAACAATGGA 351 BB940870
CR0002_BW996366 gSNP08272 CCTGTTGGCCCAGAAATAAA GCCTACAATCTGGAGGATGG 349 BW996366
CR0093_BW996410 gSNP08280 GCTTGGTAAGCTTTGGCAAT AAGCTCCTGATAGCAGCCAA 321 BW996410
CR0098_BW996414 gSNP08281 AATGATGTTGGGCTTGTGGT AGGCACATAACCAAGAGGTTC 141 BW996414
CR0140_BW996437 gSNP08283 TGTCGTCATGAAGAAAGCTAGAG CTGCGACACACTTACTTCAGC 199 BW996437
CR0230_BW996501 gSNP08292 AAACGTGCCTTTGGGGATA GGACAAATGGAACCCATGTC 223 BW996501
CR0234_BW996504 gSNP08294 AATTTCTTGGCCTGTTCCAA TTCAGTGCTTATTCAACGCAA 265 BW996504
CR0241_BW996511 gSNP08295 CGGAGGAACCTCTACTTCCC CATTTGGGATACTCGCAAGG 169 BW996511
CR0253_BW996520 gSNP08297 CATCAGTAGCAGATGGTGGG TTGTCATGACTTGCAGAAGCA 241 BW996520
CR0263_BW996526 gSNP08298 GTGCTAGCAGCAGCAACAAG TGGAACATCTCCAGCAGCTA 236 BW996526
CR0275_BW996536 gSNP08300 TTGGATTGGGCAGAAGAATC TTTATCTCACTAATGGCAATCGAG 334 BW996536
CR0284_BW996544 gSNP08302 TTATGCTTGATCAATTCATTTTCAG AAAATTTCCACGTGTGGTTG 140 BW996544
CR0597_BW996620 gSNP08318 ATTGAAGGATTTGCGACCAG CGCAAGGATTACCAGAAAGC 466 BW996620
CR0621_BW996640 gSNP08324 ACGATCCATCATCTCCTTCG ATGAAAATCAAGCGTGCCTC 443 BW996640
CR0622_BW996641 gSNP08325 CCACCGTTTTGTTTGCTTTT TCGACATCGTCCATCCATTA 541 BW996641
CR0645_BW996655 gSNP08329 TCTGTTGCAAGAGGTGGTGA GAATTGGAAGGGCTGGTGTA 382 BW996655
CR0674_BW996676 gSNP08331 ATCTGATGCTGGGCTTTCAC GAGAGCGGGGTCATATTGAA 374 BW996676
CR0684_BW996683 gSNP08333 CAAAACTCGAACGCATCAAA TGGGGGCTCCATAACAATTA 293 BW996683
CR0692_BW996688 gSNP08334 GATGCCAGCATCAATTCATTT GCATTCAAAAACATCAGCCA 184 BW996688
CR0714_BW996702 gSNP08338 TGACACAGACCCAGATCCAG AAAGAAATTTGAACCAAAATCAGC 187 BW996702
CR0730_BW996716 gSNP08341 ATCCCAGCCTTTGAGGTTCT GCTGCTCATGAAAAATACCTTG 214 BW996716
CR0747_BW996729 gSNP08342 ATTGTAGCAGCATTGGGGAC CCTGCTCCTCATGTGGAAAT 466 BW996729
CR0751_BW996732 gSNP08343 TGCAAATAATGCAACAGGTTATT TGCCCCAAGTTTCACTTATTG 210 BW996732
CR0757_BW996737 gSNP08345 ATTTTTGCAGGACCAAATGC CGAGGAAAGTCCAAGGAGTG 420 BW996737
CR1129_BW996829 gSNP08351 CGCCGGGCTATAGATGACT CCTCACGAAATGATATAGCGG 186 BW996829
CR1178_BW996864 gSNP08354 TGGGGAAAACTAGAGGAACC AGCCACAGCTTCTTTCTTGG 174 BW996864
CR1232_BW996899 gSNP08362 GTCATTCCGCAACGACTTCT GCCATCCTCATTTCCTCAAG 278 BW996899
CR1258_BW996914 gSNP08366 CTGAAATCATGACCCCAAGG TCCATTTCACAATCAGTTTCAA 403 BW996914
CR1271_BW996923 gSNP08367 GCTTGCACAATGAACACTGC AAGTGCGCATGTATTCAGGA 276 BW996923
CR1284_BW996929 gSNP08369 ACAACAGGATATTTTGAACGCC TCAAAGGAGCCCATGGAATA 243 BW996929
CR1308_BW996940 gSNP08373 GGTTTGGAAACAGAAGCAGC GTGCATCCCCTATGGTCAAG 365 BW996940
CR1324_BW996948 gSNP08375 ATCCAAATCACGACCACCAT AGTGACTGCTCCCCAATCTG 313 BW996948
CR1510_BW996977 gSNP08382 CCCACTTGGCAATCTGTTCT GGTTAGAGGCTTCCCGATTC 363 BW996977
CR1605_BW997045 gSNP08387 GACGTCTCCATCAATTCGCT GAGGATGGTTTTGACCTGGA 339 BW997045
CR1620_BW997058 gSNP08388 GTGCACCCAAGCTCCTCTAA GGGGGCATAGATACAAAGGG 372 BW997058
CR1626_BW997063 gSNP08389 GGTGGGATTTCACATCGTTT GGCTACTGCAGAAGGCAGAC 441 BW997063
CR1643_BW997075 gSNP08391 CCATTTGGAATAATCTCCCG CCTCCATAAACTCAATGCCAA 202 BW997075
CR1644_BW997076 gSNP08392 TCCACCCTATTGGAGGGAGT TTTTTGGCCATGAGATGTGA 471 BW997076
CR1664_BW997089 gSNP08394 GGGTGTAGTCTAAAGAAAGGCTGA AATTGCAAGGTTTTGGGTTG 457 BW997089
CR1668_BW997092 gSNP08395 TCTTGCCAGCAAACCATCTA AGGGTCAGCTGTTCCTGGTA 380 BW997092
CR1698_BW997111 gSNP08398 TGGAAGTTCTCACGTTGCAG ACCTTGCCCTGAACATTTTG 420 BW997111
CR1700_BW997112 gSNP08399 ATGAATGCATCCGTTCCTTC CGCTTTTGGTAGTGATGCAA 399 BW997112
CR1732_BW997139 gSNP08403 TGCAGGTCCAAACACAAATC AAGGCTCTTGAGATTGCTCG 232 BW997139
CR1770_BW997171 gSNP08408 TCCTGAGCGGGGATTAAGTA CAAAGCTCACAATCAAGGCA 383 BW997171
CJ051109_Contig1516 gSNP08414 GCTCTTTTGCCTCATCCAAG CTGTGACACCTGCAGCATTT 325 BW996954 BW996936
CJ051109_Contig1553 gSNP08423 TGTGGATCTTACGGTTGCAC TTTTTGCTGGCCTGAATCTT 471 BW996523 BW996539 BW996546
CJ051109_Contig1576 gSNP08427 TGTTCAAATGTGAGTTTAAATGTGACT TCCACAAATAGACGCGAATG 203 BW996367 BW996778
CJ051109_Contig468 gSNP08429 AGCAGAATCACAAGGGTTGG TTTCTTCAGTCCCGTTCCAC 403 BB941522 BB941264 BB941612 BB941565 BB941094 BB941555 BB941075 BB941402 BB941217 BB941582 BB941130
BB941219 BB940947 BB941220 BB941265 BB941250 BB941154
CJ051109_Contig471 gSNP08430 TGCTGCCTTCGTTACCAAAT GCCCAAGTCTGTTTCTCAGC 299 BB941601 BB941373 BB941155 BB941045 BB941059
CJ051109_Contig494 gSNP08439 AGGCAAGTGAAATAGAGGCG TGAGGGGAGTTATTGAATTGC 226 BB941518 BB941440 BB941238 BB941300
CJ051109_Contig505 gSNP08443 TTGAATTGTAACGCTATGAAGAAT CTATCAAACTACCACACCGGA 465 BB941460 BB940976
CJ051109_Contig507 gSNP08444 AGATGCTGTGTGTGTGCTCC GCCACAGACATGTTGCAGAG 278 BB941443 BB940977
CJ051109_Contig512 gSNP08446 CCCTTTTCCAAGACACCAAA CGAATTTCCTGAGTCTTCCG 198 BB941432 BB941419
CJ051109_Contig515 gSNP08447 CGATTTCTTCTGTGGGTCGT CGACGGAGCCTATTACGAAG 289 BB941386 BB941211
CJ051109_Contig518 gSNP08449 TTATACGTCAGGGGTTTGGC ACTCCATTCTCTGGCTCGAA 353 BB941375 BB941145 BB940962
CJ051109_Contig520 gSNP08451 GTTCCGGGCTTTATTTGTGA CTAATGTTGATGCGGCCTTT 445 BB941363 BB941237 BB941218 BB940942 BB941513 BB941077 BB940961
CJ051109_Contig524 gSNP08453 GAGAGGCATTCTACGATGGG GTCTTCGTTCAGGGTTGGAA 323 BB941441 BB941572 BB940952 BB941185 BB940979 BB940975 BB941061 BB941323 BB941552 BB941142 BB941133
BB941520 BB941239 BB941547 BB941499 BB941029 BB941092 BB941007 BB940953 BB941109 BB941183 BB941305
BB941232 BB941569 BB941337 BB941006 BB940926 BB941044 BB941426 BB941388 BB941514 BB941119 BB941268
BB941282 BB941053 BB941207
CJ051109_Contig525 gSNP08454 CCATTGTTGCAGGAAGCTTAT TGTCAAGTCCAATGGAAGGC 459 BB941314 BB941046 BB941005 BB941290
CJ051109_Contig529 gSNP08457 TCTGTCAAGGGAAAAGGAGC GCATCACAAGCTAGCAAAATCA 219 BB941099 BB941216 BB941206
CJ051109_Contig537 gSNP08460 TAGTCAGGAAAAGCAGGGCA AGTCCGATCCCAATCCTCTT 361 BB940999 BB941025
CJ051109_Contig538 gSNP08461 TGCTAATCGATATGGATGGTT GTAGTGCGGATTTCTTCCCC 227 BB940985 BB941296
CJ051109_Contig541 gSNP08462 TGTCTTGATACACTCTTGGATAAGTCC TTTGTTGGGGTATTTCTTCTGG 189 BB940939 BB941260
CJ051109_Contig544 gSNP08464 CCTCCTGTCTGGAAGCATTT ACTCTTTGCATTCGGTGGTC 500 BB941280 BB941225
CJ051109_Contig547 gSNP08466 TCGATGATGAAGCATTTGGA TGGGAGTCGAACTCAGAACC 391 BB941203 BB941495 BB940984
CC0007F_AU066353 gSNP08475 ATTAGAGCGATGGCAGCAGT ATGTCAAAACTGGAGCAGCC 348 AU066353
CC0038F_AU066378 gSNP08479 CCGTATACCCACCACCAAAG ATTTGAGGCAAGAGCTGACG 420 AU066378
CC0289F_AU083615 gSNP08482 GAAACCTTGAAGCTTGGTGC TTCCAGGAAGTCAGCTTTCA 331 AU083615
CC0340F_AU083665 gSNP08483 GTTTTCATTCCGTTCGAGGA ACCTCGTGCACAAACAAGTG 380 AU083665
CC0352F_AU083676 gSNP08484 TGGAAATTTCAAGCGGTGTT GGTTCGCTCAATGAGGTGAT 323 AU083676
CC0425F_AU083732 gSNP08486 CAACCTTTTTGAGGTGGAGG CATCTGCAGCAGGTTCTTGA 269 AU083732
CC0499F_AU083786 gSNP08487 TGAATTCCCAGCACATTTCA ACCACCCCCATAGCATATCA 393 AU083786
CC0514F_AU083801 gSNP08488 CTCGAGAGGGATCGAAACTG CCTCCTCCTCCTCCGATTAC 373 AU083801
CC0608F_AU083872 gSNP08490 TAATCCATCCCGTTCAAACC TGGCCTTATCATTCTCCTCG 330 AU083872
CC0782F_AU084001 gSNP08492 GCCGGGAGGTTCACTTATTT CACTTCCACGCAATCTTCAA 338 AU084001
CC0940F_AU084131 gSNP08497 TGGGGATCGATACAAAAAGG GGTCCTCACTCCATGGAACA 345 AU084131
CC0958F_AU084149 gSNP08498 TCCGTAACCCTCAACAGAGC TCAAATTGGGGCTTAACTGC 351 AU084149
CC0976F_AU084164 gSNP08499 CCTTGACAACCCGTCAAGTT TTCATGGCCATCTGTGTTTC 378 AU084164
CC0992F_AU084179 gSNP08500 TACTACATACGGGAGCCCCA AGTTTCATTCACGGCAATCC 321 AU084179
CC10065F_BW992321 gSNP08503 GCCATTCTTGGATTGTGCTC CACCATGAGACCACTTTGGTT 500 BW992321
CC10092F_BW992353 gSNP08505 AATGGACGGTCTGGTGAAAC GAGCTGCCGTTTCAAATCTC 288 BW992353
CC10128F_BW992397 gSNP08506 AAGGGCCATTACCATCCATT CCGGTAGAAAATTCCTGGGT 473 BW992397
CC1013F_AU084198 gSNP08507 GTCCTCGGATCTTGTCCTCA CTTCAAGCCTGCATTTGGTT 469 AU084198
CC10146F_BW992419 gSNP08508 TGGTGAGAAGGTGCTCAATG GGGTAGCACCCTTTCCATTA 450 BW992419
CC10154F_BW992429 gSNP08509 TAAATCCCTCCCACAGGATG TTCCAAAATTGAGCAATGAGG 518 BW992429
CC10188F_BW992474 gSNP08511 TGAAAGTTCGTGAGGGAGGT TCAGGATTGGCATGCTTACA 397 BW992474
CC1022F_AU084207 gSNP08512 TCTCCAAAAACAAACCAGCC TTAGTTCAAGGGCATGAGCA 250 AU084207
CC10301F_BW992603 gSNP08515 CCTGCTGAGGCTTGAGAGTT CCTGTGGAGCTTCTTTCAACA 464 BW992603
CC10318F_BW992625 gSNP08516 TGATGAAAACCATCTTGCCA GCAGAGTGCAGACCAACTGA 553 BW992625
CC10336F_BW992649 gSNP08518 AAGCGCTTCATCATCCATTT TTACCTTTCAAATCTGCCACG 457 BW992649
CC10374F_BW992697 gSNP08521 ACCAGACGAAACACACATGC GAGGTACATGCCAATGACCC 376 BW992697
CC10629F_BW993001 gSNP08526 ACCTAGTGCAACTGCTCGGT GTCTCCCTGTCTCCATCTGC 499 BW993001
CC10837F_BW993278 gSNP08534 CAGCAGAACTGGCGTTGAG TGGAAACCTCCTTAATCCCG 380 BW993278
CC10899F_BW993361 gSNP08535 CCTTGTCTCTGGAGAAGCTCA TTTTTCCAGAATAAGAAAATGGG 480 BW993361
CC10936F_BW993409 gSNP08536 CGCTCAACGCCTATGAACTT AACATAGGTCGGAGTCGCAC 417 BW993409
CC11039F_BW993533 gSNP08541 TGCTCGATGGCCTTATTCTC TCATGAGCACTCACGGAGAC 438 BW993533
CC11047F_BW993544 gSNP08542 CCCTAGCAGAGGAGTCCCTT CCTCATGGACTAGCCTCTCG 417 BW993544
CC1109F_AU084227 gSNP08545 TCATACATGCTCCACAGGGA TGACAAATGACTGGTCCCAA 483 AU084227
CC11126F_BW993641 gSNP08546 TCCGGGTAATTGACTTCAGC CCTTACACTTTCCAATGTCCG 428 BW993641
CC11150F_BW993676 gSNP08550 TGTGACAAGCCCTCTAAGCA TGGAACAGCCGGAATTAAAG 423 BW993676
CC11161F_BW993690 gSNP08553 CAAGAGAAACATCATGGGCA CACAAAGATTACTTGGCGACC 432 BW993690
CC11177F_BW993710 gSNP08554 CACAACTATCACGCACTTCCA TAACTGTACGGTGCTCGCAG 485 BW993710
CC11188F_BW993723 gSNP08555 ACTGGGTCGGTGCTACAAAC TCGCCTCAGTACCTGAATCC 473 BW993723
CC11208F_BW993747 gSNP08558 CTTACGAGTGCCCCAAAAAC AACCCAAAATTTGCAGACCA 321 BW993747
CC11222F_BW993763 gSNP08559 TCCTTGGGTCTGTTTAATTGC ATGATCCTTGGGGATTAGGG 512 BW993763
CC11224F_BW993765 gSNP08560 AGCCTCATCCTGTGTATGGC TGATCTTGATCTGTTGGGTCA 512 BW993765
CC11270F_BW993820 gSNP08562 GCGAAGAAGATAATGGCACG CTAGCGCGAAGCAATCAAAT 361 BW993820
CC1171F_AU084283 gSNP08566 CCACCTCGATGTTGTTGAGA ACCAATTGCCTTGTGTCCTC 339 AU084283
CC12060F_DC429828 gSNP08570 CAAAGGCAACAGATTGCAGA ACCTGTGGATTGTCTGGAGG 353 DC429828
CC12168F_DC429921 gSNP08575 CAGCAGCTGCAATGGTGTAT GCCTCTCAAACTTCCCAATG 465 DC429921
CC12266F_DC430007 gSNP08580 TTGATTGTGTGTCCTTGGGA AAGAAGAGCAAGGGTCTCCTG 560 DC430007
CC12449F_DC430170 gSNP08584 GGATTCAAACCCACCGATAA TGATTCTGGACTGGTCGTCA 469 DC430170
CC12491F_DC430203 gSNP08586 TGCCGTGTGTGAATCAATTT CCTTCCTGATAACATTGGCA 374 DC430203
CC12689F_DC430368 gSNP08593 CAAAGCAATCTGGCAATGAA CATTGCTGGTGTTTTTGGTG 253 DC430368
CC1271F_AU084367 gSNP08595 TTCACTTCCATCGTTGCAGA TGGCATTGCTACTGCTCATC 543 AU084367
CC12722F_DC430390 gSNP08596 CGGGATGATTCAAGAGGAAA ATCATCAGATTCACCGCCTC 516 DC430390
CC13037F_DC430587 gSNP08602 AAATCGTTCCTGACACTTACAAAA CGATGGATTTATCGCTGGTC 295 DC430587
CC13104F_DC430644 gSNP08606 GTCTCGACATCGATTCCCAT ACCTCCCCAGGAACCTACAG 244 DC430644
CC13177F_DC430703 gSNP08608 TCACAACTTCATTTGCCACG TACAAGGCCAGCCCATAAAC 233 DC430703
CC13261F_DC430777 gSNP08616 CAGACAGCAAGTTCCTTGACA AAACCCAGAGCTAACCTCCA 268 DC430777
CC13469F_DC430959 gSNP08631 TGAACATATTACGCCGCTCA CATGCAATGGGGACCTTTTA 299 DC430959
CC13503F_DC430988 gSNP08635 TGCAGAAAACTTGGAAAGGC GAGGGCCGTACAAAAGGTAA 239 DC430988
CC13525F_DC431007 gSNP08636 GGCGAAGACCACTTTGATGT CAGTTATGGCAACTGCCCAC 299 DC431007
CC13543F_DC431024 gSNP08638 CAATGGTAGCCTGGCATCTT GCGCCATGAATACCAGATTT 328 DC431024
CC13544F_DC431025 gSNP08639 TGACTTGATCGCAGGTCTTG AACAAACATCCGAGTTTCGC 301 DC431025
CC13658F_DC431128 gSNP08648 GGGAATGTTGATGAAGACTCTCTTA AGCAGCAAAATCCCTCTGAA 288 DC431128
CC13900F_DC431332 gSNP08668 TTATTCACAAAAATGGCCCTG TTGCATGTGCAACTTCCTTC 342 DC431332
CC13944F_DC431370 gSNP08669 TAACGTGCATTCCTTGGTGA TGGCAGAGCTTAGTTTCAAAGA 261 DC431370
CC14148F_DC431546 gSNP08692 TCCAGTTCCACGATTTCACA GCCGTAGTATACCCTCCCGT 354 DC431546
CC14320F_DC431659 gSNP08703 GCGGCTGCATTAAAATATCC AGGGCGTGGGTTACTCTTCT 346 DC431659
CC14388F_DC431710 gSNP08709 AGCTTCCAAAGTGTGCTTCG AATTGGACCTGTGTTACCCG 134 DC431710
CC14424F_DC431736 gSNP08712 GAGCAGGTTGATGGGCTTTA CAGAAAACCAGATCTGCCAA 128 DC431736
CC15140F_DC432251 gSNP08750 AGAGTTCCGAGTCCTGAGGG CCAAGTTTAAGCCAAACCCA 259 DC432251
CC15200F_DC432284 gSNP08754 GGTGGCTTTGTTGAAATGGT AAAACTGGACGCATTTGAGG 374 DC432284
CC15304F_DC432356 gSNP08761 TGCACAGCCTGGGGATAGTA GAATGAATTCAGCCGTCCTG 347 DC432356
CC15657F_DC432631 gSNP08777 CAATACCCAAAGAGCTGGGA TAAAACCAGGCAAGACCCAC 262 DC432631
CC15672F_DC432643 gSNP08778 ATGTCGTCAGGCTGCTCTTT ATGATGGGTTCTGATCCTGG 294 DC432643
CC1634F_AU084636 gSNP08785 GGCTGCAGAATAGTTTCCCA AGAGGGATCAGGAGGCAGAT 371 AU084636
CC1731F_AU084716 gSNP08786 CAAGAAAGCTGGTGCAATGA AGCAGTTTGGTTCAAGGTCC 368 AU084716
CC1947F_AU084897 gSNP08790 AAAAGGCTGCAGTGAGTCGT TTGGTGCTCCTCGTTTCTCT 334 AU084897
CC2286F_AU085141 gSNP08794 GGAGGACAACCATGTTCTGG CTGTCGTCTGCCTCGATTTT 351 AU085141
CC2385F_AU085211 gSNP08798 TTTACGAAACCAAACCCCTG CCCACATGCGTATCACTGAA 336 AU085211
CC2601F_AU085373 gSNP08802 GGTGGATGCCTTGTTGTTCT CATTGAGAATTAGCTGCTTCTTTG 384 AU085373
CC2738F_AU085481 gSNP08805 TAGGAGGAAAGGATCGCAAA CCGCTGGTTTTCTCTTGACT 327 AU085481
CC2752F_AU085494 gSNP08807 ACTCCGCACACTATCGCTCT TTCCCTTCGGCATATGACTC 351 AU085494
CC2821F_AU085546 gSNP08808 TGAGCTTCTTTGGCCAATTT TGGAGATAATGAAGAGGCGG 351 AU085546
CC2911F_AU085621 gSNP08811 CTGCTGTGAAATCTGAAGCG TGCAAAGGAAAATGAGGAAGA 288 AU085621
CC2920F_AU085628 gSNP08812 GTGAGCCAGAGGATCAGTCC AGGGTAGGCATTCACCATGA 315 AU085628
CC3011F_BP175539 gSNP08815 AGTGGAGAGTCTTCTGCCCC TCAGGCAACAAAAACAACAAA 348 BP175539
CC3301F_BP175699 gSNP08818 CCTGTTCAATCTCCACCACC TGGAGATGAAAGAGAAGGCG 336 BP175699
CC3370F_BP175742 gSNP08819 TCATTTGATATTGGGGCAGC CCAATCGCTCATAAACACGA 351 BP175742
CC3839F_BP175924 gSNP08822 GGAGCGGAGAGACTGCATAC ACTGTTTTGGCTGGTTCGAT 296 BP175924
CC3915F_BP175969 gSNP08823 AAACTCTGTGGCAGGAGGAG CTGAAGGCTGGCAGATTTTC 297 BP175969
CC4679F_BP176430 gSNP08830 ACTGTGCTTTTCCCATCCAG CCCCTCTGCACATTCAAAAT 377 BP176430
CC4684F_BP176434 gSNP08831 TCTGCAGAGACAGAGTTTACGA ATTCTGCAGAGTCCATTCGG 323 BP176434
CC4981F_BP176622 gSNP08835 CAAGAGACTCAGAGCATGGC TTTGCAATCTTTCGTTCCAA 369 BP176622
CC5068F_BP176684 gSNP08837 GAGGAGGAGAGAGGGGTGAG AAAGTCGGCGTTAGCTTGTG 192 BP176684
CC5096F_BP176704 gSNP08839 AATCCCTGAAATGGGCTCTT CACTCCTCTTCATTCCCAGC 265 BP176704
CF0033F_AU299566 gSNP08845 AGCATTGAGCATAGAGCGGT ACAGTCAACACCATCAGCCA 327 AU299566
CF0113F_AU299623 gSNP08846 ATGGACATGGAATCTCTGCC TCTGCTCTTGCCAAAGACTG 299 AU299623
CF0527F_AU299768 gSNP08847 GTGAAGGGCATCAATTGGAA GGATGGTTCCTTGCATGTTA 266 AU299768
CF0591F_AU299818 gSNP08850 GCTCAAGTCTTCACTTTGGTTG TGCTCCTCAGTGGCTCTCTT 220 AU299818
CF0703F_AU299908 gSNP08854 TGCACCAGCTTCATCTTCTG TCTTTGGAGCATTTGCAATATTTA 344 AU299908
CF0706F_AU299911 gSNP08855 CCAAAGGTGAGCCCTCATAA AAATTCAAAATGGGATACAAAGTCA 194 AU299911
CF1019F_AU300122 gSNP08861 TAGATTGCCAGGAAGAACGG AAGTAGCCCAGGCCATGTAA 505 AU300122
CFFL001_M10.f gSNP08888 GCCTAAGAGCTTTCGCCTTT AAGAGGTCCACGTCTTCCCT 520 FY262167
CFFL001_M13.f gSNP08889 AACAAGAGCATGGGGTGTTC ACTCCAGGCAAGGTTTCTCA 571 FY262170
CFFL001_O21.f gSNP08892 AGAGCTTGCAGAGAAGCTGG ACCCTGTTGCACAAAAGTCC 593 FY262222
CFFL002_B08.f gSNP08897 AAGAACCCGTTTCCATAGCC ACCCGCGATACATGGACTAC 582 FY262278
CFFL002_C11.f gSNP08900 ACTGAAAAAGCAAGCAGGGA TCATATTGCCCAGTTGGTGA 598 FY262304
CFFL002_J12.f gSNP08908 AAATTACACGGCTCTGACGC TCTGGATACAGAGGAAGCCG 558 FY262465
CFFL002_N04.f gSNP08916 TCCTTCGGACAGCATTTAGG GGAATCTGAATCACCGAGGA 560 FY262551
CFFL002_N16.f gSNP08917 TAGATGGCGAATCCCATGAT CTTCACCGGCAACTTCAAAT 582 FY262563
CFFL002_P16.f gSNP08921 CTCGAATCCCACAGCCATAC GTTTTCCATGGCAACCCTTA 525 FY262609
CFFL003_A11.f gSNP08925 CCCAAGGGATATGATGGTTG CTGTTTCTTCAAGGGTCCCA 552 FY262627
CFFL003_B18.f gSNP08926 CTACCGCTACCGCTCATCTC TGTGCATGCTTCCACATTTT 572 FY262657
CFFL003_E08.f gSNP08927 CTGTGCGTTGGAATTTGTTG GCAAACTCCTCCTCTTCCCT 587 FY262716
CFFL003_G23.f gSNP08929 AGGGTTTATGGGGTTTTTGG ATGGCACTACAAGCCCTGAC 533 FY262777
CFFL003_J02.f gSNP08932 TCCCAATTCATTTTCTTCGG ATTCGGCTTTTGGTTCTTCC 533 FY262824
CFFL003_J20.f gSNP08935 CAAGGAAATATTCGCCCAAA ACGCCCCTTAACCCTTACAC 564 FY262842
CFFL003_M08.f gSNP08938 TAAGCACAGGAATCAACCCC CGCCAATTTATTCTTGCGAT 529 FY262898
CFFL003_M11.f gSNP08939 AGGCCTGATAGGGATCGTTT CATTTCAGTGGGCCATTTTC 539 FY262901
CFFL003_M22.f gSNP08940 TTCCTATTTCATGCCAAGCA ACCGGAAACAATGCAAAGAC 592 FY262910
CFFL004_B21.f gSNP08946 CTCTCCCAATCTCAGCCAAC CCGTCGATGGTTACTCTGGT 512 FY263025
CFFL004_D03.f gSNP08947 ACCTGCAATCTTGTGGCTCT GCAAGTTCATGGACAGCCTT 535 FY263054
CFFL004_D09.f gSNP08948 CAACCGTACAGCCAAATCCT CAACACAAGAATGAGCACCG 517 FY263060
CFFL004_D13.f gSNP08949 CCTCCTGCGTCCATTACACT ACTGCTCTTAGGGCAACCAA 587 FY263064
CFFL004_E11.f gSNP08952 TTTTGTGTTTGATTCTCAGGGA TTGGAAGGCATTGAGACAGA 514 FY263086
CFFL004_E16.f gSNP08953 TATTTGTAATTCGCGCCACA CCTGACATTCTTTTGCGACA 587 FY263091
CFFL004_G10.f gSNP08954 TTTTGTGGCTTGCTATGCTG ACCAATGCAAAACCTGATCC 592 FY263133
CFFL004_G19.f gSNP08956 CACCACTCGCACAATGTTTC AGGTTGAGGAATTCGGCTTT 521 FY263142
CFFL004_L10.f gSNP08962 CGTCCTTGTTGGGATTCTTG AGAAGCCGAAGAAGAAGGGT 526 FY263252
CFFL004_M04.f gSNP08963 TCGGAAGTCTGAAGTTGCTG GCTTTCAATTTGCCAAGCTC 523 FY263270
CFFL004_M09.f gSNP08964 ACATGGAGTTGGGCTTCTTG AGCAGTAGCGGATGGTGAGT 585 FY263275
CFFL005_D10.f gSNP08977 TCAGAGTTGCTTGATTTGCG TCTCCGATCTCGACATCCTT 524 FY263439
CFFL005_D16.f gSNP08978 CTGCAGTCTTCAGGAAGGGA GAATGGCTACTCTTGGCTGC 502 FY263445
CFFL005_D20.f gSNP08979 TCAGGGTCTGGAAAATCTGG ACGGCACTCAAGCTTTCACT 576 FY263449
CFFL005_F04.f gSNP08982 TGCCCAAGTTTCAGGGTAAG TCTGCAACATCTAACGGCAC 570 FY263480
CFFL005_I09.f gSNP08985 AGTCTTTGGGGACTCCACCT CAATGGCCTGAATCTAACGC 558 FY263554
CFFL005_J03.f gSNP08989 GCTCAGAGCCTGTGGAAAAC CGGCCAAGTACAGTAGACGG 528 FY263572
CFFL005_N19.f gSNP08992 TTCTCTGGTTTGCAAGGGTT ACTGAAACTCGAATCCCCCT 513 FY263680
CFFL005_N21.f gSNP08993 GGGCTGCATCTTAACAAATTC GAGTAAACCCCGTGATCCAA 534 FY263682
CFFL005_P15.f gSNP08995 ATCTGCAATTGGTGGTTTGC CATATGCCCTTGCCCTTCTA 528 FY263723
CFFL005_P16.f gSNP08996 AGGTGTCATCCCAACGAATC TACCCAGAGAAGCCGGTATG 523 FY263724
CFFL006_B21.f gSNP08997 TGGCCATCACATGAAAGAAA TGAACGGTAATCCCAACCAT 572 FY263776
CFFL006_E22.f gSNP09001 TTTGGTTAGGTGGATCGTCTG GCGTGTGACTTCAAATGACC 465 FY263845
CFFL006_G03.f gSNP09003 GTTTCTGCAACTTCTTCGGC ACACAACAACAAACCGCAAA 577 FY263874
CFFL006_I05.f gSNP09004 CCTCAGACCCCTGAGATCAA TCCTCCGAATACCCCTTTCT 549 FY263924
CFFL006_I24.f gSNP09006 TTTGTATCAGCAATGGCAGC ACCTAATTCCATGAGTGCCG 569 FY263943
CFFL006_J13.f gSNP09007 CCTGGCAACTTCATTCCAGT TCCATACCCTGTTCCAAAGC 531 FY263956
CFFL006_J14.f gSNP09008 AGGAGGCAGAGTGACCTTCA CATTGGATACACCCAGAGGG 505 FY263957
CFFL006_L05.f gSNP09010 ATCTGGGTCGGTTAGGAGGT TCACTATGGCCCTGTGTCAA 505 FY263994
CFFL006_N06.f gSNP09014 CAGATCGTCGCAGCATTAAA ACTGCAACAAACCCAAAACC 586 FY264041
CFFL006_P05.f gSNP09017 CGGCTTATGGGAAATCTTGT GCTAAATGAATCGGGCTTGA 539 FY264085
CFFL007_A12.f gSNP09019 CAGCTGCATTTGAAGGTTGA CAGAGATGAAATGCCCTCGT 525 FY264112
CFFL007_D13.f gSNP09026 TTTGTTCTTTTCCTCTGCCG TCTTCCAAGAGTATTTTGGCCT 328 FY264184
CFFL007_D15.f gSNP09027 GCAATGCAAGCGTACAAAGA GGCATCTACAGGAGGAGCTG 508 FY264186
CFFL007_D21.f gSNP09028 TGTCCCTCGGATCTATGGTC GTGTGGGAGAAGAGCCACAT 566 FY264192
CFFL007_E08.f gSNP09031 AGCAGCTATTTGGCTATCGG CACTGGAAAGGAAGGCAAAA 599 FY264203
CFFL007_F01.f gSNP09033 GACAAGTGGGAGCTTTCTGC TTCACTGGGTTCCTTCAACC 597 FY264219
CFFL007_G11.f gSNP09036 GTCCACATTTCGCCATTTTT GTTGCAGCATGTGGTACGAA 536 FY264253
CFFL007_G19.f gSNP09037 CAAATCCGTCAGGAACACCT CAGACAGAGAATCCGCAACA 513 FY264260
CFFL007_H04.f gSNP09039 TTGAGACAACTTCAGCAGCAA CCAATTTATGCTGCCCATTT 525 FY264269
CFFL007_H15.f gSNP09040 AATTTCCCGTTGTTGTCTGG AAAATAGCAAACAGAACCCCC 533 FY264280
CFFL007_H20.f gSNP09042 TTCGGGAAGTTTTCTGTTCG AAAGCTGCAATGGTTATGCC 509 FY264285
CFFL007_I07.f gSNP09044 GTCATGCGCACTTTTTGCTA GGTCGAATTGGTCTTGAGGA 584 FY264296
CFFL007_I14.f gSNP09045 TGGCTTTGTGATCCTTTCAA ATCAAAACGGTTGGCATCAT 554 FY264303
CFFL007_K15.f gSNP09050 TCAGAGAGCGAACGGTTTTT TGCCTCAAAATTTGGACCTC 501 FY264351
CFFL007_P11.f gSNP09059 GCAACAAAACGCGACTACAA ATCGCAGTCTCCTGACTCGT 576 FY264465
CFFL008_A18.f gSNP09061 ATCAACGCCTATGGTTTTGC TTGGTGCCCTCTCCATAGTC 578 FY264495
CFFL008_B13.f gSNP09062 AAACTGGGAATATCGGGCTT AGCACCGGTGTCTGAAAATC 600 FY264514
CFFL008_C02.f gSNP09063 TTGAGCAATTACCCTACGCC AAGGCCAATCTATCTGACCTACA 575 FY264527
CFFL008_C03.f gSNP09064 CAGAGGACGCTGTAAGGAGG CCTAACCCTTTCATCCGTCA 586 FY264528
CFFL008_C15.f gSNP09066 TGGCAAGAACATCTGCAATC TTAAGGGACAAGAAACCCCC 585 FY264540
CFFL008_F22.f gSNP09071 GGGACAAACTACCAGCTCCA TATGTGAGCCCGAAACATGA 551 FY264614
CFFL008_G14.f gSNP09072 GCCTTATCCAACAACCCAAA AGGCCTAGGCTTGATTCTCC 554 FY264629
CFFL008_I21.f gSNP09074 GAAAACCCCAGAGCTGTTGA CCAATCTTCATCAGCCCAAT 554 FY264684
CFFL008_I24.f gSNP09075 CCGCATCCTTCAATTTGTCT AAGCGTGAATCAGGGGTATG 599 FY264687
CFFL008_M14.f gSNP09080 AGTGTCGGGAGGAATGATTG GAGGGCTAGAACAATGCTGC 552 FY264770
CFFL008_N14.f gSNP09082 AGATTTCCCGTGAGCTCGTA CGTACTGTGGCATCTGCACT 552 FY264793
CFFL009_B16.f gSNP09087 TGTAGGCAACCAAGTTGTGC CACCAGAGAAGGATTCGCTC 536 FY264886
CFFL009_C02.f gSNP09089 CCTGTGAATTTCCCCGTCTA AACCCAGCAGAAACGTCAAC 506 FY264895
CFFL009_D22.f gSNP09094 CTCAAACACTGCTCAACCGA TTTACGGCTACGTTATGCCC 509 FY264936
CFFL009_H10.f gSNP09098 TCTATTATTCCCGCACTGCC ACGGATCAGGTTGACCAAAG 531 FY265014
CFFL009_J21.f gSNP09101 GTTTTCTTCAATGCACGGGT ATCCTCTCACAGTGCAGCCT 507 FY265069
CFFL009_K10.f gSNP09102 CCTTCATCCACTTCTCAGGC TCACTGCCTGTGACCAGAAG 570 FY265082
CFFL009_N13.f gSNP09105 GGTCCGTGCGACATTAAGAT GCGGAGTATTTTTGCCAGAG 508 FY265155
CFFL010_B16.f gSNP09108 CTCACGGCAGGAATTATGGT TGCATTTTGCCTTGTATTGC 527 FY265250
CFFL010_B17.f gSNP09109 CCAAATTTTGATGCAGGAGG AAGACCAATCTGTCATCCCG 504 FY265251
CFFL010_C13.f gSNP09110 TCCAGGTAAAGCCTCTGGAA GAAAGCCCACAACCATTCAT 574 FY265270
CFFL010_E15.f gSNP09115 TTTTGAGATCGGGATGAAGG CCGTTCGAAAACCATCTTGT 594 FY265318
CFFL010_F19.f gSNP09118 CACCAGCGACACTTGGTCTA CAGCCGGGCATTTAGTAGTC 509 FY265346
CFFL010_F23.f gSNP09119 GATGAACAAGGCATCACACG AACTGCTATGAAACACTCCATGA 520 FY265350
CFFL010_G23.f gSNP09120 TCCTTGCTGAAGGAAGCTGT TTTGATAAGCCTTTGCCCAC 568 FY265373
CFFL010_H15.f gSNP09122 GAGGCAGAAGAAATTGGCAG GCCGATCCATTACCAGAGAA 593 FY265389
CFFL010_M03.f gSNP09126 TTTGTCTGCATGTCGAGGAG ACCGGATAACATTGGCTGAG 502 FY265493
CFFL010_O09.f gSNP09128 GGTTTGGATTCGTGAAGGAG TTTGACGAGCCCCAAACTAT 547 FY265545
CFFL010_O23.f gSNP09130 GGCGCCATCTTCTTCTTCTT TCACCAGAGCCACTAAACCC 500 FY265557
CFFL011_F12.f gSNP09144 ATGGCGAAACACCAAGTAGG CAGACAGATAGAGGCGAGGG 502 FY265706
CFFL011_F18.f gSNP09145 GGATTTCTCGTTTTAGGGGG CTCCCCAAGAAGTTGGCATA 439 FY265712
CFFL011_G01.f gSNP09146 AGCGTCCTGTATGGAGGTTG GGCAGTCACAAGGCAAACTT 593 FY265719
CFFL011_I08.f gSNP09150 CATCTAGCACCGCTGAACAA TTTATGGAGTGCCAACCTCC 518 FY265772
CFFL011_I16.f gSNP09151 TGAAGGGCTTGAAAGTTGCT CCTATCGACCTCCTCCTTCG 557 FY265780
CFFL011_J19.f gSNP09153 TTGTGATGTCAAGCTGGGAG AAAGCCGGCCTAACAAAAAG 415 FY265805
CFFL011_K01.f gSNP09154 ATTTGCAATTGGAAGCAACC ACTGTGCGAAGAGCTGGAAT 523 FY265810
CFFL011_L06.f gSNP09157 TCTCGACCGACCTCAAAACT TGCATTCAACAAACCAAGGA 550 FY265838
CFFL011_M23.f gSNP09160 ATGCTTTGAATGAACTGGGG AATCCATGAGCAAAAGCCAT 576 FY265876
CFFL011_N14.f gSNP09162 GACCGCCTCCTGATACAAAA TTGAAATGGAAAGCCCAGAC 588 FY265891
CFFL011_O02.f gSNP09163 ACGCCCATTGAGGATTACTG ATTCCCATGGAGATCCTTCC 545 FY265903
CFFL012_A06.f gSNP09168 TGGTTTGCTCTATCCCTTGG TATCGATCTGGGTGGCTTTC 563 FY265953
CFFL012_F16.f gSNP09177 ACGGTGCTCTGTGTAAGGCT CGGACAGATCTACAGCGTGA 529 FY266068
CFFL012_F19.f gSNP09178 ACCTGCTGGCAAAAGAAGAA TCCACAAGGTTGTTAAGCCC 576 FY266071
CFFL012_G17.f gSNP09180 CGCTTTGGGACAGTAAGCTC ACCCTGAAATCATCGCAGTC 585 FY266092
CFFL012_H13.f gSNP09183 ACGGTTGTAAGTGAATCGGG AACATGTGGAGCTGAAACCC 388 FY266111
CFFL012_H17.f gSNP09184 AAGTTGCACGCTTACTGCCT CATGAGCCGCTTTTGTATCA 546 FY266115
CFFL012_H18.f gSNP09185 GTGATGGAATGGAATGCTGC CTGTTCGATGTGTCCCTGAG 319 FY266116
CFFL012_I08.f gSNP09186 TCAGGATCCATCTAATCCGC GCTTTGCTGTTTCCTCCAAC 574 FY266130
CFFL012_K01.f gSNP09187 GGGAAATCCAGAAGAGGAGG TCCCCAACGCAGTTCTTATC 516 FY266168
CFFL012_N19.f gSNP09191 GCGGCAACATAGCCATAAAT CCTCCCTTGCAGGATCACTA 574 FY266254
CFFL012_N20.f gSNP09192 GGGACTGCGGTTCTCAATTA CATGCCGCAACAAACTAAAA 573 FY266255
CFFL012_O01.f gSNP09193 GGTTGGAAATCTGAAGGCAA CCAATTTTTGCACCACCTTT 585 FY266260
CFFL012_P10.f gSNP09196 GTCATCGTGGAAACAACGTG TTAGGGCTTTTCTGGGGTTT 551 FY266291
CFFL013_B22.f gSNP09200 AGTGGTGGGAGTGGATTGAG TTGTCTGTTCGATCCTGCTG 524 FY266349
CFFL013_C01.f gSNP09201 TTGCAGGTAAATCCAAAGGG TCAGCACACTGCCTCAATTT 558 FY266352
CFFL013_C06.f gSNP09202 GTGGGTTTTCAGTTCGAGGA GAGAGCAAGAATTCAAAGGCA 474 FY266357
CFFL013_D22.f gSNP09204 ACCACCTAAGCAGTCAACGC GGTGAGAAGAAGGGAGGGAC 560 FY266395
CFFL013_E17.f gSNP09206 TCTGTACGTCTTTGAGGCCA CTTCTGCAGGTACACATGGAA 500 FY266413
CFFL013_F22.f gSNP09209 CAAGGATGAAAATGGGCACT AGTTTGTTATTGTTGCCCGC 524 FY266440
CFFL013_I18.f gSNP09214 ATATAATTGTCGGGGGAGGC AGCAAAAAGAAGGCGTTGAA 581 FY266505
CFFL013_J13.f gSNP09216 CACTGGTCCCTCCACATCTT TTTCTTGGGCAGGAATTGTC 544 FY266524
CFFL013_K11.f gSNP09219 TTTCATCTGGGCATCTGTGA TGGACCATGTGGGCATATAA 547 FY266546
CFFL013_M18.f gSNP09221 TCCCACCAATGTTAATGCAG CATTTATATACAGGTGCAATGCC 584 FY266598
CFFL013_N10.f gSNP09223 AAAACGCATTGACAGGCTTC CCCGAACAAGCAATCTCATT 527 FY266612
CFFL013_O03.f gSNP09226 CAGGCCGTCACAGGTAAGAT TCGGAACACAGATGCAAGAA 562 FY266629
CFFL013_O04.f gSNP09227 GAAGAATTTGAGGCCAAGCA GCAACTGAAACCCTTTGAGC 531 FY266630
CFFL014_A15.f gSNP09228 AAACCATGTCTGCCCTGTTC AAGTTCACAAATTGGCCCAG 560 FY266687
CFFL014_C09.f gSNP09234 TCTAGGCTTGCCATCGAAGT TCATCACATGCTGGTGTCCT 572 FY266727
CFFL014_F20.f gSNP09238 CTGTATAGCTCGCCACCCTC GACAAGCACATGATTTCCCC 399 FY266798
CFFL014_G11.f gSNP09241 GCCTACAGTTTGATCGGGAG ATTGGGTTTTGGCCATGTAA 598 FY266812
CFFL014_H05.f gSNP09242 AATACGAACACTCGATCCCG CCGAGGTTTCAGATCACCAT 526 FY266830
CFFL014_K08.f gSNP09244 TCTAAGCTTGGCTCGGATCT TGCAAAACCCAAAGTGGTAA 507 FY266897
CFFL014_M07.f gSNP09247 GCCCAAGACCACAATTCGTA GAAGCGGGTTTTCCTTTTCT 575 FY266939
CFFL014_M17.f gSNP09249 AACCTCGACATGGAAGCAAC ACATCACTACTCGGCGGAAC 512 FY266949
CFFL014_M21.f gSNP09250 ATACACTGGCGGTTTTCAGG GCAATCCACATCTAGGCGAT 542 FY266953
CFFL015_D02.f gSNP09263 ATGCCTCAAGCAAAGTCTGA AAAGGCGGATCACACCATAC 324 FY267090
CFFL015_G02.f gSNP09266 CGGAGTTCTATGAAGATGGCA ATACTCCCAATGCCAGCAAG 341 FY267155
CFFL015_G24.f gSNP09268 AACTTCATCGGAAATGCCAC GTTGGTCACATGATGCTGCT 429 FY267176
CFFL015_L12.f gSNP09273 CAGGTCCAGTGATGTTGGTG AAACGGAAAAACAGGGGAAC 552 FY267280
CFFL015_M21.f gSNP09276 CCTCGCATAGCCATTACTGC ATCGAAACCCAATTAACCCC 438 FY267312
CFFL015_O16.f gSNP09280 TATTGCAGATCGCAGTTTGG CTCTATAATCCGCGGCTCTG 525 FY267354
CFFL015_O20.f gSNP09281 TTAAGCGCAAGTAGGGGCTA CACTTCCGACAGAGAAAGGG 525 FY267358
CFFL015_P13.f gSNP09282 TACCCCTTTTTCCGTTTTCC TCTAGCAGAACCATTTCGCC 571 FY267375
CFFL016_A05.f gSNP09283 TGCTTGCAGGATAACCACTG GCTGGCAAATGTAAACCGAT 511 FY267391
CFFL016_A14.f gSNP09284 TGACATTTTTGCTCCCCTCT GCTGCCACCAGGAATTACAT 515 FY267399
CFFL016_E07.f gSNP09289 CCCAATTCAGGGGATAGGAT TTGAAGCACAGCATCTGGAG 522 FY267487
CFFL016_F18.f gSNP09290 GGTGGGCACTGTTTAAGATGA GCACTGCAAGCATAGCAAAG 432 FY267519
CFFL016_G06.f gSNP09291 CTAAATGGAGGAGCTGCCAA ATCCCTTGTTACGCTTGTGC 533 FY267529
CFFL016_H11.f gSNP09295 AAGGTTATTCCGTTTGCACG GATGGCACGGGTACTTGACT 555 FY267558
CFFL016_H12.f gSNP09296 GGGAAACTTGTGGAGGACAA AAAGGTGGGTCACAAGCAAG 475 FY267559
CFFL016_I05.f gSNP09297 TGCCATGGAATGTGTTGATT CATCCTCCCTTGACGTTGAT 503 FY267575
CFFL016_I06.f gSNP09298 ATGGTGGCTACAGTTTTGGG CCGAGAAGGGGGATAAGTTC 588 FY267576
CFFL016_I24.f gSNP09300 GAGGTGCCGTCTTTCTTGTC AAGCCTTTGCCTCAGCATTA 558 FY267593
CFFL016_J06.f gSNP09301 TTTTCAATCGGTAGCCGTTC CTGTTTCACGCGTTGTGAGT 504 FY267599
CFFL016_J22.f gSNP09302 ACGATTTTGTTTGGGAGACG GCTCCAACAGAATCCTCCAC 593 FY267615
CFFL016_L02.f gSNP09303 CGAGAGCGTTGCATAAATCA CCCTAAATGGGAATGCAAGA 526 FY267641
CFFL017_A22.f gSNP09317 TGCACTTCATTCATTTCCCA CCATACAAATCGAACCCACC 518 FY267776
CFFL017_P13.f gSNP09340 CATGTTTATTTTGCAGCGGA ACAGTTAAGGCAATGACGCC 526 FY268099
CFFL017_P19.f gSNP09342 CAGGAAATGGGTCCTCTTCA CCCACTTCATGCAATTTGTG 508 FY268105
CFFL017_P24.f gSNP09344 CCTTGTTCTTGGACAGGCAT TTCCCAAGGAAGTGGGTATG 535 FY268110
CFFL018_A01.f gSNP09345 AAGGGTATTGAGAGCAGGGG TGCACGAACACTGCAAAAAC 551 FY268111
CFFL018_A08.f gSNP09347 TGTGCTTGGATTCCTCCACT CTTAAACGCCGTTGTTCCAT 455 FY268118
CFFL018_B01.f gSNP09349 TTGGTGCATTGTTTGTAGCC TGGGAAACCATCTTCCAGAG 590 FY268133
CFFL018_C05.f gSNP09351 TAAGGCATTAGGGTCGGAGA TTGGAGGCAATAAATCCGTC 536 FY268160
CFFL018_E02.f gSNP09354 AAAGGCCTGCTTTCTTGTCA AGCCTTTGACCTTCCTGTGA 533 FY268204
CFFL018_G13.f gSNP09358 AAGAAGATCACAGGGGCTCA TCCGGAATCTGAGGCTTCTA 563 FY268261
CFFL018_H09.f gSNP09359 TGGGAGTTGGGCTTTATGTC CAGGGTAAATCTCCTGGCAA 501 FY268281
CFFL018_O01.f gSNP09365 ATGCACGTCAAAACATCCAA AGGCAGAGACATCACGAACC 547 FY268435
CFFL018_O03.f gSNP09366 GACTGGAGGGAAAGCTCCTC TCATCTCCAAGAGTCGAGCA 463 FY268437
CFFL018_P05.f gSNP09367 ATGTTCTCGTTGGTCGGAAC GATGTAAGGGCTACCTCGCA 579 FY268463
CFFL019_C18.f gSNP09370 CTCGTTGCCCACCTAGAGAC GCACCTTTCGTGTGACCTTT 198 FY268546
CFFL019_E08.f gSNP09373 TGGGCCAAGCCTATAAAATG GCAAAATCTCAACTTTGAGGGA 336 FY268583
CFFL019_F02.f gSNP09376 TTTAGGGGAAATGGCAGAAA ATGCATTAGCATCACTGGCA 488 FY268601
CFFL019_F08.f gSNP09377 TGCGTCGTTGAAATCACTGT CACAAGAAGCCACCAAATGA 225 FY268607
CFFL019_F16.f gSNP09378 GCTTCCCACCTCACTGGTAA ATGAAAAGGGGCAAGGATCT 481 FY268615
CFFL019_G11.f gSNP09380 TCGTTTTGATGCA